We narrowed to 9,464 results for: CAG
-
Plasmid#80351PurposeExpression of GFP-tagged, dominant negative VPS4 mutantDepositorAvailable SinceJan. 27, 2017AvailabilityAcademic Institutions and Nonprofits only
-
TET-pLKO.1 PURO shSMAD4 #2
Plasmid#83091PurposeLentiviral shRNA vector for inducible knockdown of human SMAD4DepositorAvailable SinceFeb. 28, 2019AvailabilityAcademic Institutions and Nonprofits only -
pJMP1346
Plasmid#119274Purposeknockdown folA in K. pneumoniaeDepositorInsertsgRNA folA (K. pneumoniae)
ExpressionBacterialMutationD10A and H840AAvailable SinceJan. 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
AAVS1-tdTomato
Plasmid#159275PurposeHuman AAVS1 targeting vector for knockin of a CAGGS promoter-driven tdTomato cassette (cloned between AgeI and PacI). Targeted cells will be puromycin resistant.DepositorInserttdTomato
UseAAV; S1 knockin donor vectorExpressionMammalianPromoterCAGGSAvailable SinceSept. 25, 2020AvailabilityAcademic Institutions and Nonprofits only -
pTRIPZ shTREX1
Plasmid#127700PurposeDoxycyclin inducible shRNA knockdown of both human and mouse TREX1 geneDepositorAvailable SinceFeb. 3, 2020AvailabilityAcademic Institutions and Nonprofits only -
TDP-43 mRuby
Plasmid#216225PurposeTDP-43 with a C-terminal mRuby tag for expression in mammalian cells.DepositorAvailable SinceApril 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
TRE-SEAP
Plasmid#210511PurposeSEAP reporter vector for LAUNCHER systemDepositorInsertsecreted alkaline phosphatase
ExpressionMammalianPromoterTetOAvailable SinceJan. 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
PLKO.1-G3BP1-3'UTR
Plasmid#136038PurposeG3BP1 shRNA (Targeting 3'UTR) inserted into the PLKO.1 plasmid (GCCTGTAAGAAATACAGGATT)DepositorAvailable SinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pSLQ1371-sgSTAT3-1
Plasmid#121425PurposesgSTAT3-1 sequence: GTCAGGATAGAGATAGACCAG. Lentiviral mouse U6 (mU6) promoter-driven expression vector that coexpessed Puro-T2A-mCherry from a CMV promoter.DepositorInsertsgSTAT3-1
UseCRISPR and LentiviralTagsmCherryExpressionMammalianPromotermouse U6Available SinceApril 22, 2019AvailabilityAcademic Institutions and Nonprofits only -
TDP-43 mCerulean
Plasmid#216227PurposeTDP-43 with a C-terminal mCerulean tag for expression in mammalian cells.DepositorAvailable SinceApril 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
TRIN-shMYB.2652
Plasmid#105575PurposeDox-inducible mir30 MYB shRNA/dsRED expression with Venus marker and neo resistanceDepositorInsertMYB shRNA #2652
UseRNAi and RetroviralExpressionMammalianPromoterTREAvailable SinceMarch 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
PLKO.1-G3BP1-CDS
Plasmid#136039PurposeG3BP1 shRNA (Targeting CDS) inserted into the PLKO.1 plasmid (CGGGAATTTGTGAGACAGTAT)DepositorAvailable SinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1 shPIK3CD.v1 puro
Plasmid#58706PurposeLentiviral shRNA vector for knockdown of human PIK3CDDepositorAvailable SinceSept. 22, 2014AvailabilityAcademic Institutions and Nonprofits only -
Cas9 MDC123
Plasmid#59184Purpose2x35S promoting Glycing Max codon optimized Cas9 with bar plant selectionDepositorInsertGlycine Max codon optimized Cas9
UseCRISPRExpressionPlantPromoter2X35SAvailable SinceNov. 21, 2014AvailabilityAcademic Institutions and Nonprofits only -
G10 Cas9 MDC123
Plasmid#59187PurposeG10 promoting Glycing Max codon optimized Cas9 (N and C terminus NLS) with bar plant selectionDepositorInsertGlycine Max codon optimized Cas9
UseCRISPRExpressionPlantPromoterG10Available SinceDec. 19, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCRIS
Plasmid#120424PurposeThis plasmid encodes the complete CRISPR/dCas9 machinery for repressing transposition of the following bacterial Insertion Sequences: IS1, IS3, IS5, and IS150.DepositorInsertCRISPR spacers targeting IS1, IS5, IS3, IS150
UseCRISPR and Synthetic BiologyExpressionBacterialPromoterconstitutiveAvailable SinceJan. 17, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-FLEX-SaCas9-U6-sgSlc18a2
Plasmid#124849PurposeMutagenesis of Slc18a2DepositorInsertSlc18a2 (Slc18a2 Mouse)
UseAAV, CRISPR, and Mouse TargetingAvailable SinceMay 3, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-FLEXfrt-SaCas9-U6-sgSlc18a2
Plasmid#124862PurposeMutagenesis of Slc18a2DepositorInsertSlc18a2 (Slc18a2 Mouse)
UseAAV, CRISPR, and Mouse TargetingAvailable SinceMay 3, 2019AvailabilityAcademic Institutions and Nonprofits only -
pMP416
Plasmid#134996PurposedCas9-m6A Writer. Methylates adenines at local GATC sites. pCAG-dCas9-NLS-3xFLAG-3AC3L linker-EcoDam(N132A)DepositorInsertpCAG-dCas9-NLS-3xFLAG-3AC3L linker-EcoDam(N132A)
UseSynthetic BiologyTags3xFLAG, E coli Dam(N132A), and dCas9ExpressionMammalianAvailable SinceMarch 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
BII-Sh-FUCCI-Luc
Plasmid#133364PurposePiggybac vector for shRNA-mediated knockdown, co-expressed with FUCCI cell cycle reporterDepositorInsertClover-Geminin-IRES-mKO2-Cdt1
TagsHA-tagged Clover-GemininExpressionMammalianMutationN/APromoterCMV enhancer and hEf1a (CpG free)Available SinceJan. 3, 2020AvailabilityAcademic Institutions and Nonprofits only