We narrowed to 9,225 results for: CAG
-
Plasmid#90895Purpose3rd generation lentiviral gRNA plasmid targeting human SMC3DepositorInsertSMC3 (Guide Designation H8.1)
UseCRISPR and LentiviralTagsExpressionMutationPromoterU6Available SinceJuly 18, 2017AvailabilityAcademic Institutions and Nonprofits only -
pSLQ2827 pHR: U6-SpsgSV40 CMV-PYL1-KRAB-IRES-mCherry
Plasmid#84260PurposeExpresses Sp sgSV40 gRNA with ABA-inducible KRAB and mCherry for diametric regulationDepositorInsertsSp sgSV40
PYL1-KRAB
UseCRISPR and LentiviralTagsIRES-mCherry and PYL1ExpressionMammalianMutationPromoterCMV and mouse U6Available SinceNov. 28, 2016AvailabilityAcademic Institutions and Nonprofits only -
pENTR/U6 HDAC5 shRNA
Plasmid#32222DepositorInsertshRNA against mouse HDAC5 (Hdac5 Mouse)
UseRNAi; Gateway u6 entry vectorTagsExpressionMutationPromoterhuman U6Available SinceSept. 16, 2011AvailabilityAcademic Institutions and Nonprofits only -
ATP1A1_G8_Dual_sgRNA
Plasmid#178104PurposeCoselection for PE3 in human cells. Vector for tandem expression of ATP1A1 G8 sgRNA with a user-specified PE3 nick sgRNA from two independent U6 promoters. Cloning of oligos using BbsI sites.DepositorInsertATP1A1 G8 sgRNA + user-specified sgRNA
UseCRISPR; Prime editingTagsExpressionMammalianMutationPromoterTandem U6 promotersAvailable SinceDec. 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
HSF1 KO
Plasmid#200207PurposegRNA for HSF1 KODepositorAvailable SinceAug. 28, 2023AvailabilityAcademic Institutions and Nonprofits only -
Tol2-LyzC-GFP-U6ac-cdk2-guides
Plasmid#168250Purpose"neutrophil specific GFP with ubiquitous cdk2 sgRNAs"DepositorInsertcdk2 sgRNAs
UseCRISPRTagsExpressionMutationPromoterAvailable SinceMarch 16, 2022AvailabilityAcademic Institutions and Nonprofits only -
pGEX-6P1-Ataxin3Q22-C14A
Plasmid#22113DepositorAvailable SinceSept. 16, 2009AvailabilityAcademic Institutions and Nonprofits only -
5xgRNA: PTEN exon 5, p53 exon 8, SMAD4 exon 2, p53 exon 7, SMAD4 exon 9 probasin_mTQ2_FlpO
Plasmid#68357PurposeThe prostate specific promoter controls expression of FlpO linked to a blue flourescent protein. gRNA towards PTEN ex5, p53 ex7 and 8, and SMAD4 ex2 and ex 9 are expressed by the U6 promoter.DepositorInserts5xgRNA: PTEN exon 5, p53 exon 8, SMAD4 exon 2, p53 exon 7, SMAD4 exon 9
FlpO recombinase
UseCRISPRTagsmTurquoise2 (BFP)ExpressionMammalianMutationPromoterU6 and synthetic Probasin ARRx2Available SinceOct. 5, 2015AvailabilityAcademic Institutions and Nonprofits only -
pSC43
Plasmid#104817PurposeCRISPR/Cas9 1xplex gRNA targeting Glyma.04g057400 (Dcl3a-1). Also expresses Cas9 from Gmubi promoter from rolD promoterDepositorInsertGlyma.04g057400
UseCRISPRTagsExpressionPlantMutationPromoterAvailable SinceFeb. 8, 2018AvailabilityAcademic Institutions and Nonprofits only -
CENPF C5.1 gRNA
Plasmid#90616Purpose3rd generation lentiviral gRNA plasmid targeting human CENPFDepositorInsertCENPF (Guide Designation C5.1)
UseCRISPR and LentiviralTagsExpressionMutationPromoterU6Available SinceJuly 13, 2017AvailabilityAcademic Institutions and Nonprofits only -
pJG488
Plasmid#91196PurposeWDV replicon T-DNA for gene targeting in wheat scutella, H840A double nickase (nTaCas9_H840A+gUbi8+gUbi1+donor)DepositorInsertnTaCas9_H840A+gUbi8+gUbi1+donor
UseCRISPRTagsExpressionPlantMutationPromoterAvailable SinceSept. 29, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLG1-puro-sgATL3-2
Plasmid#109010PurposeCRISPRi knockdown of targeted gene (to be used with Addgene #102244 or other dCas9-KRAB constructs)DepositorInsertATL3-sgRNA #2 (ATL3 Human)
UseLentiviralTagsExpressionMammalianMutationPromotermU6 promoterAvailable SinceAug. 22, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPR sgHAL
Plasmid#102315Purposegenetic depletion of HALDepositorAvailable SinceJuly 13, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLKO-sh-Myocardin
Plasmid#100769PurposeLentiviral expression of shRNA targeting MYOCDDepositorInsertLenti-sh-Myocardin
UseLentiviralTagsExpressionMammalianMutationPromoterhU6Available SinceSept. 8, 2017AvailabilityAcademic Institutions and Nonprofits only -
pGEX-6P1-Ataxin3Q22-UIM*
Plasmid#22114DepositorAvailable SinceOct. 1, 2009AvailabilityAcademic Institutions and Nonprofits only -
WPXL LEFTY2 gRNA
Plasmid#101924PurposeLEFTY2 gRNA used for targeted demethylation is inserted into the WPXL lentiviral backbone.DepositorInsertLEFTY2 enhancer targeting gRNA
UseLentiviralTagsExpressionMutationPromoterAvailable SinceDec. 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
NDC80 F11.1 gRNA
Plasmid#90786Purpose3rd generation lentiviral gRNA plasmid targeting human NDC80DepositorInsertNDC80 (Guide Designation F11.1)
UseCRISPR and LentiviralTagsExpressionMutationPromoterU6Available SinceJuly 18, 2017AvailabilityAcademic Institutions and Nonprofits only -
pUDP010
Plasmid#101166PurposeE. coli/S. cerevisiae amdS shuttle vector expressing a ribozyme flanked g-RNA for Cas9 editing targeting the gene SeILV6 in S. pastorianus (HH-gRNASeILV6-HDV)DepositorInsertHH-gRNA-HDV targetting SeILV6 in S. pastorianus
UseCRISPRTagsExpressionYeastMutationPromoterScTDH3Available SinceDec. 4, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCY5.1kh
Plasmid#160297PurposeYeast CRISPR plasmid targeting the kanMX and hphMX cassettesDepositorInsertssgRNA expression cassette (with guide targeting hph: GACCTGATGCAGCTCTCGGA)
URA3MX selection cassette
sgRNA expression cassette (with guide targeting kan: TGTTTTGCCGGGGATCGCAG)
Cas9
UseCRISPRTags8xHis-tag and SV40 NLSExpressionMutationPromoterAvailable SinceSept. 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA1-d5-HT2BR
Plasmid#221827PurposePlasmid to express gRNA1 (ttcagtttgcccggtttaac) for editing at the end of Drosophila 5-HT2BR coding frameDepositorInsertd5-HT2BR gRNA1 (CG42796 Fly)
UseCRISPRTagsExpressionInsectMutationPromoterDrosophila U6 promoterAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only