We narrowed to 5,265 results for: crispr cas9 expression plasmids
-
Plasmid#207104PurposepX330 based plasmid for expression of Cas9 and the AGATTCTCAGCCTGAAAGCC sgRNA to target the 53BP1 coding sequence.DepositorInsertAGATTCTCAGCCTGAAAGCC
ExpressionMammalianPromoterCMV and U6Available SinceMarch 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMini-CMV-NLS-R-IscB-VR4-NLS (D60A, H243E, H269N, R270Q)_T2A_mCherry_U6-ωRNA
Plasmid#246431PurposeAll-in-one plasmid. Expresses R-IscB in mammalian cells. ssRNase enhancing mutations (H243E, H269N, R270Q) included.DepositorInsertsO.gue IscB-VR4 (H243E, H269N, R270Q) with RuvC dead mutations (D60A) and delta-TID
mCherry
ωRNA
TagsSV40 NLS, Thosea asigna virus 2A peptide, and nuc…ExpressionMammalianMutationchanged Aspartic Acid 60 to Alanine, changed Hist…PromoterCMV and U6Available SinceJan. 6, 2026AvailabilityAcademic Institutions and Nonprofits only -
pInt-ERCreER
Plasmid#190040PurposeThis is an integration donor plasmid to insert a DNA fragment for doxycycline inducible ERT2-Cre-ERT2 at the AAVS1 locus. It works with an AAVS1 targeting CRISPR/Cas9 construct (Addgene #72833).DepositorInsertERT2-Cre-ERT2 flanked by AAVS1
UseCRISPR and TALENExpressionMammalianAvailable SinceJan. 16, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCMV-PE2-p53DD
Plasmid#196582PurposeMammalian expression of SpCas9 prime editor 2 with P2A-p53DDDepositorInsertPE2-P2A-mp53DD
ExpressionMammalianMutationΔ40-903PromoterCMVAvailable SinceMarch 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
pEF-XMAS-2xStop
Plasmid#164412PurposeTransient Reporter for Editing Enrichment (TREE) Plasmid. GFP turns on with adenosine base editing (ABE). 2 stop codons.DepositorInsertmCherry
UseCRISPR and Synthetic BiologyTagsT2A-GFPExpressionMammalianPromoterEF1-alphaAvailable SinceAug. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
LCV2_AAVS1_sgRNA_2
Plasmid#155088Purposelentiviral plasmid expressing Cas9 and gRNA targeting AAVS1 safe harbor locusDepositorInsertAAVS1_sgRNA_2
UseCRISPR and LentiviralExpressionMammalianPromoterU6 promoterAvailable SinceAug. 7, 2020AvailabilityAcademic Institutions and Nonprofits only -
CGBE1-VRQR (pBM1192)
Plasmid#140254PurposeCMV promoter expression plasmid for UNG(E.coli)-rAPOBEC1(R33A)-nCas9_VRQR-P2A-EGFPDepositorInserteUNG-BE4max(R33A)_VRQR-ΔUGI
ExpressionMammalianMutationR33A in rAPOBEC1, VRQR mutations in SpCas9, D10A …PromoterCMVAvailable SinceAug. 5, 2020AvailabilityAcademic Institutions and Nonprofits only -
miniCGBE1-VRQR (pBM1173)
Plasmid#140255PurposeCMV promoter expression plasmid for rAPOBEC1(R33A)-nCas9_VRQR-P2A-EGFPDepositorInsertBE4max(R33A)_VRQR-ΔUGI
ExpressionMammalianMutationR33A in rAPOBEC1, VRQR mutations in SpCas9, D10A …PromoterCMVAvailable SinceAug. 5, 2020AvailabilityAcademic Institutions and Nonprofits only -
SECURE BE4max(R33A) (pBM608)
Plasmid#140251PurposeCMV promoter expression plasmid for rAPOBEC1(R33A)-nCas9-UGI-UGI-P2A-EGFPDepositorInsertBE4max(R33A)
ExpressionMammalianMutationR33A in rAPOBEC1, D10A in Cas9PromoterCMVAvailable SinceAug. 5, 2020AvailabilityAcademic Institutions and Nonprofits only -
pORFE0005
Plasmid#112073PurposeAtDeadCAS9 D10A H840A without stop codon module CDS1nsDepositorInsertAtDeadCAS9 D10A H840A without stop codon
UseCRISPRExpressionPlantMutationPlant codon optimized dCas9 D10A S. pyogenesAvailable SinceAug. 3, 2018AvailabilityAcademic Institutions and Nonprofits only -
px330-GAPDH
Plasmid#136940PurposeNHEJ assay. sgRNA/Cas9 plasmid. Target DSB at human GAPDH; induce CD4+ deletion rearrangement by pairing w/ px330-CD4DepositorAvailable SinceFeb. 14, 2020AvailabilityAcademic Institutions and Nonprofits only -
px330-CD4
Plasmid#136938PurposeNHEJ assay. sgRNA/Cas9 plasmid. Target DSB at human CD4; induce CD4+ deletion rearrangement by pairing w/ px330-GAPDHDepositorAvailable SinceFeb. 14, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCAG-BE4max-P2A-EGFP (pRZ33)
Plasmid#140083PurposeCAG promoter expression plasmid for human codon optimized BE4max C-to-T base editor with P2A-EGFPDepositorInsertHuman codon optimized pCAG BE4max with P2A-EGFP
TagsP2A-EGFPExpressionMammalianMutationD10A (SpCas9)PromoterCAGAvailable SinceMarch 2, 2021AvailabilityAcademic Institutions and Nonprofits only -
pML107-PMR1
Plasmid#226264PurposePlasmid expressing Cas9 and gRNA ACATGACCGTATCTAAACTT which targets the PMR1 geneDepositorAvailable SinceOct. 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLCHKO_HPRT1_exon2_1_Lb
Plasmid#155051PurposeLentiviral plasmid for expressing U6 driven hybrid guide (hg)RNA for deletion of HPRT1 exon 2 using SpCas9 and LbCas12a nucleases (CHyMErA system)DepositorInsert(hg)RNA for deletion of HPRT1 exon 2
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceAug. 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
pET28b-DiCas7-11-His
Plasmid#234482PurposePlasmid for bacterial expression and purification of DiCas7-11 protein (human codon-optimized)DepositorInsertDiCas7-11
UseCRISPRTags6xHisExpressionBacterialAvailable SinceApril 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
peSCBE3-NG-HF1-Hypa
Plasmid#218166PurposeThis plasmid harbors the base editor eSCBE3-NG-HF1-Hypa along with an sgRNA cloning cassette, facilitating high-efficiency and high-fidelity base editing at targets bearing NG PAM in Streptomyces.DepositorInsertsescbe3-NG-HF1-Hypa
a programmable sgRNA cloning cassette
UseCRISPR; Sgrna transcriptionExpressionBacterialMutationMutation in the portion of deaminase hAPOBEC3A : …PromoterrpsL promoterAvailable SinceMay 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
peSCBE3-NG
Plasmid#218163PurposeThis plasmid harbors the base editor eSCBE3-NG along with an sgRNA cloning cassette, facilitating high-efficiency cytosine base editing at targets bearing NG PAM in Streptomyces.DepositorInsertsescbe3-NG
a programmable sgRNA cloning cassette
UseCRISPR; Sgrna transcriptionExpressionBacterialMutationMutation in the portion of deaminase hAPOBEC3A : …PromoterrpsL promoterAvailable SinceMay 13, 2024AvailabilityAcademic Institutions and Nonprofits only -
Tol2_8xCTS-ECFP
Plasmid#200249PurposeZebrafish transgenics; Plasmid encodes the sgRNA2_8xCTS-ECFP reporter and could be stably integrated in the zebrafish genome using Tol2 transgenesisDepositorInsert8xCTS-ECFP
UseZebrafish expressionAvailable SinceJuly 18, 2023AvailabilityAcademic Institutions and Nonprofits only -
LCV2_mClover3_LacZ
Plasmid#155103Purposelentiviral plasmid expressing mClover3, Cas9 and a gRNA targeting LacZDepositorInsertLacZ_sgRNA_2
UseCRISPR and LentiviralExpressionMammalianPromoterU6 promoterAvailable SinceAug. 7, 2020AvailabilityAcademic Institutions and Nonprofits only