We narrowed to 9,536 results for: APP
-
Plasmid#251345PurposeMitochondria matrix targeted HaloTag with 4 mitochondria targeting sequences. CMV promoter.DepositorInsertHaloTag
ExpressionMammalianPromoterCMVAvailable SinceApril 22, 2026AvailabilityAcademic Institutions and Nonprofits only -
pCMV-scFv-GCN4-StayGold-IRESv4-HaloTag-tdMCP-tdP2A-tdPCP-mCherry
Plasmid#241143PurposeExpresses Anti-GCN4 scFv-StayGold, HaloTag-tdMCP, and tdPCP-mCherry to track mature and nascent SunTag-tagged proteins and track MS2 and PP7-tagged mRNADepositorInsertsAnti-GCN4 scFv
tdMCP
tdPCP
Tags(n2)oxStayGold(c4) E147D, 3x mCherry, and HaloTag…ExpressionMammalianPromoterCMVAvailable SinceOct. 21, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
pCMV-scFv-GCN4-sfGFP-tdP2A-Frankenbody-FLAG-mScarlet3-IRESv4-HaloTag-tdMCP
Plasmid#241141PurposeExpresses Anti-GCN4 scFv-sfGFP, anti-FLAG frankenbody-mEGFP, and HaloTag-tdMCP to track mature and nascent SunTag and FLAG-tagged proteins and MS2-tagged mRNADepositorInsertsAnti-GCN4 scFv
anti-FLAG frankenbody
tdMCP
TagsHaloTag, mEGFP, and sfGFPExpressionMammalianPromoterCMVAvailable SinceSept. 3, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
pLV.EF1α.mEmerald.CD9.miR9T
Plasmid#170452PurposeLentiviral plasmid that encodes mEmerald-CD9 fusion protein with microRNA 9 tandem cassette to restrict expression to microglia with EF1-alpha promoter.DepositorAvailable SinceMay 27, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLV_CMV_Prss-AtagIB-Halo-KDEL
Plasmid#251342PurposeER targeted anti-Alfatag intrabody tagged with Halotag, Lentiviral backbone, CMV promoter.DepositorInsertalfatagscfv
UseLentiviralTagsHaloTagExpressionMammalianPromoterCMVAvailable SinceApril 24, 2026AvailabilityAcademic Institutions and Nonprofits only -
pOTTC1664 - pAAV SYN1 mGas6(delta)-Myc-DDK
Plasmid#202541PurposeAn adeno-associated viral vector expressing murine Gas6 with deletion of (F50-E275) fused Myc and DDK epitopes from a synapsin promoterDepositorAvailable SinceJune 20, 2023AvailabilityAcademic Institutions and Nonprofits only -
pOTTC1663 - pAAV SYN1 mGas6-Myc-DDK
Plasmid#202540PurposeAn adeno-associated viral vector expressing murine Gas6 fused Myc and DDK epitopes from a synapsin promoterDepositorAvailable SinceJune 20, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-syn-AICD-IRES-hrGFP
Plasmid#107548Purposehigh transduction efficiency AAV-mediated synapsin promoter-dependent expression of AICD (last 50 amino acids of APP) and IRES-mediated co-expression of hrGFPDepositorAvailable SinceMay 1, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-AICD-NLS-IRES-hrGFP
Plasmid#107543PurposeAAV-mediated expression of AICD (last 50 amino acids of APP) with Nuclear Localisation Signal (NLS: CCAAAAAAGAAGAGAAAGGTA) at C-term end and IRES-mediated co-expression of hrGFPDepositorAvailable SinceMay 1, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-AICD-NES-IRES-hrGFP
Plasmid#107544PurposeAAV-mediated expression of AICD (last 50 amino acids of APP) with Nuclear Export Signal (NES: CTCCCTCCACTAGAGCGACTAACCTTA) at C-term end and IRES-mediated co-expression of hrGFPDepositorAvailable SinceMay 2, 2018AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-CTSB
Plasmid#158443PurposeGateway Cloning compatible entry vector for the human CTSB gene.DepositorInsertCTSB (CTSB Human)
UseGateway CloningAvailable SinceAug. 19, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLEX307-CTSB-G418
Plasmid#158465PurposeConstitutive lentiviral expression of human CTSB.DepositorAvailable SinceAug. 10, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLEX307-CTSB-puro
Plasmid#158463PurposeConstitutive lentiviral expression of human CTSB.DepositorAvailable SinceAug. 10, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLEX307-CTSB-blast
Plasmid#158464PurposeConstitutive lentiviral expression of human CTSB.DepositorAvailable SinceAug. 10, 2020AvailabilityAcademic Institutions and Nonprofits only -
pET-Sac-Abeta(MC1-40)
Plasmid#127152PurposeExpresses N-terminal cysteine Abeta(1-40)DepositorAvailable SinceJuly 9, 2019AvailabilityAcademic Institutions and Nonprofits only -
pSelAct-KO
Plasmid#174374PurposePlasmid for unmarked deletions, pUC19 backbone, Apr resistant casette, codA::app counterselection casette, gateway compatibleDepositorTypeEmpty backboneUseVector for 2-step knockout by homologous recombin…PromoterN/AAvailable SinceMarch 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
pET-MBP-mSA2
Plasmid#52319PurposeSolubly expresses monomeric streptavidin containing S25H mutation in E. coli as an MBP fusion. App Microbiol & Biotech 98, 6285-6295 (2014)DepositorInsertmonomeric streptavidin 2
TagsFLAG, His, MBP, and TEVExpressionBacterialMutationS25H mutation compared to streptavidinPromoterT7Available SinceJuly 15, 2014AvailabilityAcademic Institutions and Nonprofits only -
pET-Trx-mSA2
Plasmid#52320PurposeSolubly expresses monomeric streptavidin containing S25H mutation in E. coli as a thioredoxin fusion. App Microbiol & Biotech 98, 6285-6295 (2014)DepositorInsertmonomeric streptavidin 2
TagsFLAG, His, S tag, TEV site, and ThioredoxinExpressionBacterialMutationS25H mutation compared to streptavidinPromoterT7Available SinceJuly 15, 2014AvailabilityAcademic Institutions and Nonprofits only -
pDESTmycPABPC4
Plasmid#19877DepositorAvailable SinceJan. 9, 2009AvailabilityAcademic Institutions and Nonprofits only -
pCI-MS2V5-PABPC1 MLLEmut M161A/D165K
Plasmid#65810Purposeexpression of PABPC1-MS2 fusion, double mutant.DepositorInsertPABPC1 (PABPC4 Human)
TagsMS2 stem loops and V5ExpressionMammalianMutationMLLEmut M161A/D165KPromoterCMVAvailable SinceSept. 17, 2015AvailabilityAcademic Institutions and Nonprofits only