We narrowed to 16,142 results for: GRN;
-
Plasmid#112733PurposeGsk3b targeting gRNA cloned into px552 (SpGuide) plasmid.DepositorInsertGFP
UseAAV and CRISPRExpressionMammalianAvailable SinceMay 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(Nprl2-g1)-PGKpuroBFP-W
Plasmid#105037PurposeLentiviral gRNA plasmid targeting mouse Nprl2 , co-expression of TagBFPDepositorAvailable SinceSept. 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(Nprl2-g2)-PGKpuroBFP-W
Plasmid#105038PurposeLentiviral gRNA plasmid targeting mouse Nprl2 , co-expression of TagBFPDepositorAvailable SinceSept. 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
pS23.U6<ActB.mus_C-term-KI_gRNA
Plasmid#207408PurposegRNA from a U6 promoter targeting the mouse ActB near the 3' end of the ORF. Used for C-terminal knockin by DSB repair. [Lab plasmid ID: TU260]DepositorInsertActB
UseCRISPR and Mouse TargetingPromoterU6Available SinceNov. 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-U6-CB2gRNA-CBh-mCherry
Plasmid#91948PurposeExpression of gRNA for mouse CB2 cannabinoid receptor and mCherryDepositorInsertmCherry
UseAAVAvailable SinceSept. 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
pSico_U6-Pan-PGC1a sgRNA
Plasmid#165426PurposeExpression of gRNA against human Total PGC-1a variantsDepositorInsertgRNA against human Total PGC-1a variants (PPARGC1A Synthetic, Human)
UseCRISPR and LentiviralExpressionMammalianAvailable SinceApril 27, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAC-U63-tgRNA-nlsBFP
Plasmid#169029PurposegRNA-marker vector contain a U6:3 promoter, gRNA scaffold, and a Ubi-mTagBFP-NLS marker.DepositorTypeEmpty backboneUseCRISPRExpressionInsectPromoterU6:3Available SinceJune 10, 2021AvailabilityAcademic Institutions and Nonprofits only -
pBbdCas9S(-10AC12)_Psyn-sgRNArodA
Plasmid#149661Purposeall-in-one CRISPRi vector for targeting B. burgdorferi rodADepositorInsertdCas9, lacI, sgRNArodA
UseCRISPRExpressionBacterialPromoterPflaB, PpQE30(-10AC12), PsynAvailable SinceOct. 26, 2020AvailabilityAcademic Institutions and Nonprofits only -
pBbdCas9S(RBSmut)_Psyn-sgRNAflaB
Plasmid#149588Purposeall-in-one CRISPRi vector for targeting B. burgdorferi flaBDepositorInsertdCas9, lacI, sgRNAflaB
UseCRISPRExpressionBacterialPromoterPflaB, PpQE30, PsynAvailable SinceJan. 7, 2021AvailabilityAcademic Institutions and Nonprofits only -
pX601‐mhCMV‐ABEmaxNGA‐C3‐ E53ogRNA
Plasmid#187063PurposeNpu Split C-terminal half of ABEmaxNGA with gRNA targeting mdx4cv nonsense mutationDepositorInsertNpu Split C-terminal half of ABEmaxNGA with gRNA targeting mdx4cv nonsense mutation
UseAAV and CRISPRExpressionMammalianPromotermhCMVAvailable SinceAug. 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(Nelfb-g1)-PGKpuroBFP-W
Plasmid#105023PurposeLentiviral gRNA plasmid targeting mouse Nelfb , co-expression of TagBFPDepositorAvailable SinceSept. 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(Nelfb-g2)-PGKpuroBFP-W
Plasmid#105024PurposeLentiviral gRNA plasmid targeting mouse Nelfb , co-expression of TagBFPDepositorAvailable SinceSept. 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(Nelfcd-g1)-PGKpuroBFP-W
Plasmid#105025PurposeLentiviral gRNA plasmid targeting mouse Nelfcd , co-expression of TagBFPDepositorAvailable SinceSept. 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(Nelfcd-g2)-PGKpuroBFP-W
Plasmid#105026PurposeLentiviral gRNA plasmid targeting mouse Nelfcd , co-expression of TagBFPDepositorAvailable SinceSept. 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
pBbdCas9S(RBSmut)_Psyn-sgRNAftsI
Plasmid#149590Purposeall-in-one CRISPRi vector for targeting B. burgdorferi ftsIDepositorInsertdCas9, lacI, sgRNAftsI
UseCRISPRExpressionBacterialPromoterPflaB, PpQE30, PsynAvailable SinceOct. 26, 2020AvailabilityAcademic Institutions and Nonprofits only -
pM116: CasRx VEGFA presgRNA
Plasmid#166868PurposeU6-driven expression of human VEGFA targeting presgRNA compatible with CasRx.DepositorInsertHuman VEGFA targeting presgRNA
UseCRISPRExpressionMammalianPromoterU6Available SinceJuly 1, 2021AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9-Puro HLAG-2B-sgRNA
Plasmid#182552PurposeCas9 from S.pyogenes with 2A-Puro, and the 2B-sgRNA to targeting exon 2 of human HLA-G geneDepositorInserthSpCas9-2A-Puro-HLAG-2B-sgRNA
UseCRISPRExpressionMammalianPromoterCbhAvailable SinceMay 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pT7-SpCas9_sgRNA-site2 (RTW448)
Plasmid#160137PurposeT7 promoter expression plasmid for in vitro transcription of SpCas9 sgRNA with spacer #2DepositorInsertSpCas9 sgRNA with spacer #2 (spacer=GTCGCCCTCGAACTTCACCT)
UseIn vitro transcription of sgrna from t7 promoterPromoterT7Available SinceFeb. 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAN-PBAD-sgRNA-scramble
Plasmid#62285Purposeexpression of scramble sgRNA from the arabinose-inducible promoterDepositorInsertscramble sgRNA
UseCRISPRExpressionBacterialPromoterpBADAvailable SinceApril 8, 2015AvailabilityAcademic Institutions and Nonprofits only -
tRNA-gRNA position [n] (GB1207)
Plasmid#75408PurposetRNA and scaffold for the assembly of GBoligomers for the last position (positon [n]) of a polycistronic tRNA-gRNA (2- and 3-part multiplexing)DepositorInserttRNA-gRNA position [n]
UseCRISPR and Synthetic BiologyExpressionPlantAvailable SinceAug. 5, 2016AvailabilityAcademic Institutions and Nonprofits only