We narrowed to 24,325 results for: CHI;
-
Plasmid#218250Purpose1) Ectopic expression of MAAP protein variant in mammalian cells. 2) Packaging MAAP variant sequence into lentivirus for stable expression in mammalian cells.DepositorInsertMembrane-Associated Accessory Protein Variant SL01V9 driven by CMV promoter
UseLentiviralPromoterCMVAvailable SinceOct. 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCW57-CMV-MAAP-SL08V9
Plasmid#218251Purpose1) Ectopic expression of MAAP protein variant in mammalian cells. 2) Packaging MAAP variant sequence into lentivirus for stable expression in mammalian cells.DepositorInsertMembrane-Associated Accessory Protein Variant SL08V9 driven by CMV promoter
UseLentiviralPromoterCMVAvailable SinceOct. 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCW57-CMV-MAAP-SL01
Plasmid#218248Purpose1) Ectopic expression of MAAP protein variant in mammalian cells. 2) Packaging MAAP variant sequence into lentivirus for stable expression in mammalian cells.DepositorInsertMembrane-Associated Accessory Protein Variant SL01 driven by CMV promoter
UseLentiviralPromoterCMVAvailable SinceOct. 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
FgH1tUTG-sgRNA.FOXA-ZEB2_CRISPRd
Plasmid#216170PurposeExpress the gRNA targeting the FOXA-binding site in the human ZEB2 locus for the CRISPRd experimentDepositorInsertsgRNA- FOXA.bs- ZEB2.locus
UseLentiviralTagsEGFPAvailable SinceJuly 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
FgH1tUTG-sgRNA.Control-ZEB2_CRISPRd
Plasmid#216172PurposeExpress the gRNA targeting the control site in the human ZEB2 locus for the CRISPRd experimentDepositorInsertsgRNA- Control- ZEB2.locus
UseLentiviralTagsEGFPAvailable SinceJuly 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
LRG-sgRNA.FOXA-ZEB2_CRISPRd_v2
Plasmid#216173PurposeExpress the gRNA targeting the FOXA-binding site in the human ZEB2 locus for the CRISPRd experimentDepositorInsertsgRNA- FOXA.bs- ZEB2.locus
UseLentiviralTagsEGFPAvailable SinceJuly 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pEVOL-tac-EcTyrRS-VSMA*-lpp-tRNA_CUA^EcTyr
Plasmid#218766Purposeencodes EcTyrRS-VSMA* and EcTyr-tRNA-TAGDepositorInsertEcTyrRS-VSMA*
ExpressionBacterialMutationY37V, D167G, D182S, F183M, L186A, D265RPromotertacIAvailable SinceJune 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pTY186 EGFP-T2A-ALFA-ORF6 SARS-CoV-2
Plasmid#204976PurposeCo-express EGFP and SARS-CoV-2 ORF6 N-terminally labeled with ALFA tagDepositorAvailable SinceMarch 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-VcnTS-E1015A
Plasmid#213415PurposeVinculin tension sensor (VcnTS) with a single directionally asymmetric, force strengthening (DAFS) variant point mutation (E1015A).DepositorInsertVcnTS-E1015A (VCL Chicken, Synthetic)
ExpressionMammalianMutationMutated vinculin glutamic acid 1015 to alanine (E…PromoterCMVAvailable SinceFeb. 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-VcnTS-E1021A
Plasmid#213416PurposeVinculin tension sensor (VcnTS) with a single directionally asymmetric, force strengthening (DAFS) variant point mutation (E1021A).DepositorInsertVcnTS-E1021A (VCL Chicken, Synthetic)
ExpressionMammalianMutationMutated vinculin glutamic acid 1021 to alanine (E…PromoterCMVAvailable SinceFeb. 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-VcnCS-E1015A
Plasmid#213412PurposeVinculin conformation sensor (VcnCS) with a single directionally asymmetric, force strengthening (DAFS) variant point mutation (E1015A).DepositorInsertVcnCS-E1015A (VCL Chicken, Synthetic)
ExpressionMammalianMutationMutated vinculin glutamic acid 1015 to alanine (E…PromoterCMVAvailable SinceFeb. 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-VcnCS-E1021A
Plasmid#213413PurposeVinculin conformation sensor (VcnCS) with a single directionally asymmetric, force strengthening (DAFS) variant point mutation (E1021A).DepositorInsertVcnCS-E1021A (VCL Chicken, Synthetic)
ExpressionMammalianMutationMutated vinculin glutamic acid 1021 to alanine (E…PromoterCMVAvailable SinceFeb. 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDY279
Plasmid#182959PurposeStr resistant,CoE1* ori. CRISPR/Cas9 gRNA under constitutive J23119 promoter. gRNA targeting E. coli ptsI codon 2~9. HRT has synonymous mutations in ptsI. (for 1st round editing)DepositorInsertgRNA (ttcaggcattttagcatccc), homologous repair template for ptsI
UseSynthetic BiologyExpressionBacterialAvailable SinceJan. 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDY281
Plasmid#182960PurposeAmp resistant, CoE1* ori. CRISPR/Cas9 induced by AHTc, gRNA under constitutive J23119 promoter. gRNA targeting E. coli ptsI codon 2~9. HRT has synonymous mutations of ptsI. (for 2nd round editing)DepositorInsertgRNA (acctggtgaagccaatattc), homologous repair template for ptsI
UseSynthetic BiologyExpressionBacterialAvailable SinceJan. 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLINE1ΔORF2-scFvFc
Plasmid#206021PurposeThe ORF2 sequence was removed from pLINE1-scFvFcDepositorInsertmouse LINE1 vector harboring an scFv-Fc expression unit, lacking the ORF2 sequence
ExpressionMammalianAvailable SinceDec. 19, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLINE1ΔORF1-2-scFvFc
Plasmid#206022PurposeThe ORF1 and ORF2 sequences were removed from pLINE1-scFvFcDepositorInsertmouse LINE1 vector harboring an scFv-Fc expression unit, lacking the ORF1 and ORF2 sequences
ExpressionMammalianAvailable SinceDec. 18, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLV-Puro_CI-hCOL4A5-Nluc_R1683X
Plasmid#198111Purposelentiviral expression of hCOL4A4_R1683Xin mammalian cellsDepositorAvailable SinceApril 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLV-Puro_CI-hCOL4A5-Nluc_C1684X
Plasmid#198112Purposelentiviral expression of hCOL4A4_C1684X in mammalian cellsDepositorAvailable SinceMarch 31, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLV-Puro_CI-hCOL4A5-Nluc_C29X
Plasmid#198107Purposelentiviral expression of hCOL4A5_C29X in mammalian cellsDepositorAvailable SinceMarch 31, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLV-Puro_CI-hCOL4A5-Nluc_R1563X
Plasmid#198109Purposelentiviral expression of hCOL4A4_R1563Xin mammalian cellsDepositorAvailable SinceMarch 31, 2023AvailabilityAcademic Institutions and Nonprofits only