We narrowed to 5,265 results for: mos
-
Plasmid#129502PurposeExpresses AausFP4 constitutively in E. coli (most strains)DepositorInsertAausFP4
ExpressionBacterialPromotersynthetic constitutive (stationary phase) promote…Available SinceFeb. 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
R0063 (pLuxR-pR)_AB
Plasmid#66012PurposeMoClo Basic Part: Controllable promoter - pLuxR(pR) - luxR regulated (right promoter, weak constitutive down regulated by LuxR, C0062 in combination with homoserine lactone (HSL)) [A:R0063:B]DepositorInsertControllable promoter
UseSynthetic BiologyAvailable SinceJan. 21, 2016AvailabilityAcademic Institutions and Nonprofits only -
pPKm-231
Plasmid#90500PurposepSIN - EF-1alpha - MTS - tFd - P2A - MTS - tFNR, vector encoding for mitochondrial-tagged Thermosynechococcus elongates Ferredoxin (Fd) and Ferredoxin-NADP(+) oxireductase (FNR), under EF-1alpha promoterDepositorInsertmito-tFD and mito-tFNR
UseLentiviralAvailable SinceApril 4, 2018AvailabilityAcademic Institutions and Nonprofits only -
pPKm-232
Plasmid#90501PurposepSIN - EF-1alpha - MTS tHO1 - P2A - MTS - tPCYA, vector encoding for mitochondrial-tagged Thermosynechococcus elongates Heme Oxigenase-1 (HO1) and Phycocyanobilin:ferredoxin oxireductase, under EF-1alpha promoterDepositorInsertmito-tHO1 and mito-tPCYA
UseLentiviralAvailable SinceApril 4, 2018AvailabilityAcademic Institutions and Nonprofits only -
pMpGWB422
Plasmid#68687PurposeGateway binary vector designed for transgenic research with Marchantia polymorpha as well as other plantsDepositorTypeEmpty backboneTagsModified EAR motif plant-specific repression doma…ExpressionPlantPromoterCauliflower mosaic virus 35S promoterAvailable SinceJune 24, 2016AvailabilityAcademic Institutions and Nonprofits only -
pQTEV-C21orf7
Plasmid#34810DepositorAvailable SinceMarch 22, 2013AvailabilityAcademic Institutions and Nonprofits only -
pART7::CLOMELEON
Plasmid#247987PurposeTransient expression of the indicator protein CLOMELEON for monitoring chloride concentrations in the cytoplasm of plant cells.DepositorInsertCLOMELEON (CFP-YFP fusion with ENLYFQG-linker)
Tags6xHisExpressionPlantMutationCFP-variant: K26R, F64L, S65T, Y66W, N146I, M153T…PromoterCauliflower Mosaic Virus 35S promoter (GenBank AJ…Available SinceJan. 5, 2026AvailabilityAcademic Institutions and Nonprofits only -
MBP_TS-B1AR_Trx_PreSc_NdeI_AgeI
Plasmid#247768PurposeThis plasmid is a modified version of pRG/III-hs-MBP (Addgene plasmid #121676), designed for the expression of a functional β1-adrenergic receptor (β1AR) in E. coli.DepositorInsertThermostable Turkey B1-adrenergic receptor (TS-B1AR)
TagsMBP–(GS)5–HRV 3C site–(GS)5–NdeI site_ B1AR_AgeI …ExpressionBacterialPromoterlac promoterAvailable SinceDec. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
pBIOS1458
Plasmid#171715Purposeexpresses maize Glutamine Synthetase ZmGln1-3 cDNA under the control of the Cassava Vein Mosaic Virus promoter (CsVMV) (cassette 1) and the maize Rubisco small subunit promoter (ZmRbcS) (cassette 2)DepositorInsertZmGln1-3
ExpressionPlantAvailable SinceSept. 16, 2024AvailabilityAcademic Institutions and Nonprofits only -
pNMSB96
Plasmid#199316PurposeMosSCI insertion of flp-18p::lox2272::mTagBFP2::tbb-2 3'UTR::lox2272::ACR1::SL2::jRGECO1a::let-858 3'UTR at ttTi5605DepositorInsertflp-18p::lox2272::mTagBFP2::tbb-2 3'UTR::lox2272::ACR1::SL2::jRGECO1a::let-858 3'UTR
ExpressionWormMutationmTagBFP2 from pJJR81, C. elegans codon optimized …Promoterflp-18Available SinceAug. 17, 2023AvailabilityAcademic Institutions and Nonprofits only -
hnRNPA2_LC_nocharge_wR
Plasmid#139119Purposeexpress hnRNPA2 LC with no charged residues with R added backDepositorAvailable SinceDec. 7, 2020AvailabilityAcademic Institutions and Nonprofits only -
pET28a_6HT-TBP6.7(R47A)
Plasmid#112722PurposeArg47 within TBP6.7 is the most critical residue in terms of forming interactions with WT TAR. Mutating this amino acid to Ala results in ~600-fold reduction in Kd.DepositorInsert6His-TEV-TBP6.7(R47A)
Tags6His-TEVExpressionBacterialMutationR47APromoterT7Available SinceAug. 8, 2018AvailabilityAcademic Institutions and Nonprofits only -
R0063 (pLuxR-pR)_EB
Plasmid#66013PurposeMoClo Basic Part: Controllable promoter - pLuxR(pR) - luxR regulated (right promoter, weak constitutive down regulated by LuxR, C0062 in combination with homoserine lactone (HSL)) [E:R0063:B]DepositorInsertControllable promoter
UseSynthetic BiologyAvailable SinceJan. 21, 2016AvailabilityAcademic Institutions and Nonprofits only -
R0063 (pLuxR-pR)_FB
Plasmid#66014PurposeMoClo Basic Part: Controllable promoter - pLuxR(pR) - luxR regulated (right promoter, weak constitutive down regulated by LuxR, C0062 in combination with homoserine lactone (HSL)) [F:R0063:B]DepositorInsertControllable promoter
UseSynthetic BiologyAvailable SinceJan. 21, 2016AvailabilityAcademic Institutions and Nonprofits only -
R0063 (pLuxR-pR)_GB
Plasmid#66015PurposeMoClo Basic Part: Controllable promoter - pLuxR(pR) - luxR regulated (right promoter, weak constitutive down regulated by LuxR, C0062 in combination with homoserine lactone (HSL)) [G:R0063:B]DepositorInsertControllable promoter
UseSynthetic BiologyAvailable SinceJan. 21, 2016AvailabilityAcademic Institutions and Nonprofits only -
pcDNA-Dest47- R5A-K5A N23 C11orf83-GFP
Plasmid#65846PurposeMammalian expression of the mutated N terminal part (R5A-K5A N23, transmembrane part of 23 aa) of C11orf83/UQCC3 fused to GFP protein (C-ter)DepositorAvailable SinceJuly 7, 2015AvailabilityAcademic Institutions and Nonprofits only -
pcDNA-Dest47- R5D-K6D N23 C11orf83-GFP
Plasmid#65847PurposeMammalian expression of the mutated N terminal part (R5D-K5D N23, transmembrane part of 23 aa) of C11orf83/UQCC3 fused to GFP protein (C-ter)DepositorAvailable SinceJuly 7, 2015AvailabilityAcademic Institutions and Nonprofits only -
Magoh198delG
Plasmid#30481DepositorAvailable SinceJune 6, 2011AvailabilityAcademic Institutions and Nonprofits only -
pGD-p19
Plasmid#196326Purpose35S promoter-driven expression of the tomato bushy stunt virus p19 RNA silencing suppressorDepositorInserttomato bushy stunt virus p19
ExpressionPlantPromoterduplicated cauliflower mosaic virus 35S promoterAvailable SinceMay 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-HIS3b
Plasmid#87402PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting HIS3b sequence AATATAGAGTGTACTAGAGG in yeast chromosome 15.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting HIS3b
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only