We narrowed to 6,501 results for: nls
-
Plasmid#250253PurposeHomology donor for knock-in of CRISPRi system into CLYBL locus with addgene plasmids 62196 and 62197. Lox-Stop-Lox requires cre delivery for activation.DepositorInsertdCas9-mTagBFP-KRAB
UseCRISPRTagsHA-2xSV40 NLS-mTagBFP-KRABExpressionMammalianPromoterCAGGSAvailable sinceJan. 30, 2026AvailabilityAcademic Institutions and Nonprofits only -
LLP778_Traptavidin-p65HSF1-CO
Plasmid#211771PurposeAviTag counterpart binding domain, Traptavidin, fused to transcriptional activator p65HSF1, with sfGFP selectionDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertTraptavidin-p65HSF1
Tags3xV5ExpressionMammalianMutationLast 300 bp codon-optimised (CO) to detect p65HSF…PromoterpEF1a and pSV40Available sinceDec. 15, 2023AvailabilityAcademic Institutions and Nonprofits only -
LLP776_SpyCatcher-p65HSF1-CO
Plasmid#211769PurposeSpyTag counterpart binding domain, SpyCatcher, fused to transcriptional activator p65HSF1, with GFP selectionDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertSpyCatcher-p65HSF1
Tags3xFLAGExpressionMammalianMutationLast 300 bp codon-optimised (CO) to detect p65HSF…PromoterpEF1a and pSV40Available sinceDec. 15, 2023AvailabilityAcademic Institutions and Nonprofits only -
pTRE-BI-aaAFB2
Plasmid#207839PurposeInducible AFB2 Plasmids for rapid depletion of GFP-tagged proteins in mammalian cellsDepositorInsertsatAFB2
mCherry
miniIAA7
VHH-GFP4
Tags3X FLAG-Tag and weak NLSExpressionMammalianMutationAll K mutated to RPromoterTRE3G BI promoterAvailable sinceDec. 11, 2023AvailabilityAcademic Institutions and Nonprofits only -
pDIV313
Plasmid#204956PurposeAMA1 plasmid with Aspergillus optimized Mad7, hph (hygromycin) resistance marker and sgRNA targeting albA locus in A. nigerDepositorInsertsMad7
hph (hygromycin resistance marker)
sgRNA (CAGCAATGCTTCCATGCAATT) targeting albA locus in A. niger flanked by a tRNA-Gly repeat
UseCRISPR; Fungal expressionTagsSV40 NLSExpressionBacterialPromoterAspergillus fumigatus U3 promoter, Aspergillus ni…Available sinceNov. 21, 2023AvailabilityAcademic Institutions and Nonprofits onlyCited by -
AV44_pCAG.Cas9-D10A.gRNA.S1
Plasmid#199258PurposeExpression construct encoding SpCas9-D10A nickase and an AAVS1-targeting guide RNADepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertsSpCas9-D10A nickase
AAVS1-targeting gRNA
UseCRISPRTagsSV40 NLSExpressionMammalianMutationD10APromoterCAG promoter and RNA polymerase III promoter for …Available sinceApril 28, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAcGFP-Hyg-CTCF-Nterm-N1
Plasmid#131800PurposeExpresses the [N-terminus of human CTCF (a.a. 2-265)]-GFP in mammalian cellsDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertCTCF (CTCF Human)
TagsGFPExpressionMammalianMutationdeleted amino acids 796-2181 (the N-terminus is l…Available sinceMay 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
pTE3330
Plasmid#107534PurposeExpresses Lb crRNA and human codon optimized LbCpf1(RVR mutant) in mammalian cells.DepositorInsertsLb crRNA
hLbCpf1(RVR mutant)
Tags3xHA and NLSExpressionMammalianMutationG532R, K538V, Y542RPromoterCMV and human U6Available sinceMarch 30, 2018AvailabilityAcademic Institutions and Nonprofits only -
pNS35 (multiAsCas12a piggyBac)
Plasmid#217336PurposepiggyBac expression of multiAsCas12aDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertmultiAsCas12a
UseCRISPRTags6xMycNLS and HA-SV40NLS-P2A-TagBFP2ExpressionMammalianMutationR1226A/E174R/S542R/K548RPromoterCAGAvailable sinceMarch 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pvPE-V3
Plasmid#240287PurposeEncodes third generation porcine endogenous retrovirus-derived prime editing (pvPE) system into mammalian cells for gene editing.DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertpvPE-V3
UseCRISPRTagsSV40 NLSExpressionMammalianPromoterCMVAvailable sinceOct. 8, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLV-REPORT(PGK/CMV)-GRE
Plasmid#172336PurposeGal4 Response elementDepositorPublicationInsertsmonomeric nuclear Tomato
d2eGFP
HygR
UseLentiviral and Synthetic BiologyTags3x SV40 NLSExpressionMammalianPromoterPGK/CMVAvailable sinceJune 26, 2023AvailabilityAcademic Institutions and Nonprofits only -
PB-PE SpG
Plasmid#179081PurposeNOTE: An improved version of this plasmid is now available. See Addgene plasmid #242072. All-in-one prime editor piggyBac transposon, SpG variantDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertSpCas9 SpG_H840A-PE2-MMLV-RT(dBB)-P2A-PAC_dTK(dBB)
UseCRISPR and Synthetic Biology; Piggybac transposonTagsSV40 NLSExpressionMammalianMutationD1135L, S1136W, G1218K, E1219Q, R1335Q, T1337RPromoterCAGAvailable sinceJan. 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
PB-PE xCas9
Plasmid#172652PurposeAll-in-one prime editor piggyBac transposon (xCas9)DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertxCas9_H840A-PE2-MMLV-RT(dBB)-P2A-PAC_dTK(dBB)
UseCRISPR and Synthetic Biology; Piggybac transposonTagsSV40 NLSExpressionMammalianMutationA262T, R324L, S409I, E480K, E543D, M694I, E1219VAvailable sinceNov. 16, 2021AvailabilityAcademic Institutions and Nonprofits only -
(517) SB KRAB-SadCas9 U6-gStop
Plasmid#163023PurposeSleeping Beauty TET-On expression of CRISPRi with gSTOP gRNADepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertMammalian codon-optimized SadCas9
UseTransposonTagsKRAB and myc NLSExpressionMammalianPromoterTet-OnAvailable sinceJan. 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
nuc-yHS1-M7A,H102A
Plasmid#159168PurposeNuclear labile heme reporterDepositorInsertnuc-yHS1-M7A,H102A
TagsSV40 NLSExpressionYeastMutationMutated both Met 7 and His 102 of the cyt b562 mo…PromoterGPDAvailable sinceSept. 29, 2020AvailabilityIndustry, Academic Institutions, and Nonprofits -
Click editor (CE1) mRNA expression vector - T7-5'UTR-PCV2-nCas9-EcKlenow-3'UTR-polyA (CJT472)
Plasmid#217808PurposeExpression vector for mRNA production of the click editor construct (CE1; PCV2-nCas9-EcKlenow)DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsert5'UTR-PCV2-XTEN-nSpCas9-BPNLS-EcKlenow(exo-)-BPNLS-3'UTR
UseCRISPR; In vitro transcription; t7 promoterTagsBPNLSExpressionMammalianMutationnSpCas9(H840A); EcKlenow(-exo;D355A/E357A)PromoterT7Available sinceSept. 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
pTE3334
Plasmid#107537PurposeExpresses Mb crRNA and human codon optimized MbCpf1(RVR mutant) in mammalian cells.DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertsMb crRNA
hMbCpf1(RVR mutant)
Tags3xHA and NLSExpressionMammalianMutationN576R, K582V, N586RPromoterCMV and human U6Available sinceMarch 30, 2018AvailabilityAcademic Institutions and Nonprofits only -
CD8a-hnRNP-M-EGFP
Plasmid#86054PurposeA mammalian expression plasmid encoding CD8a luminal and transmembrane domains followed by hnRNP-M (PY nuclear localization signal of hnRNP-M) and C-terminus EGFP.DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertCD8a (CD8A Human)
TagsGFPExpressionMammalianMutationCD8a luminal and transmembrane domians along with…PromoterCMVAvailable sinceMay 8, 2017AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pGG442
Plasmid#165616PurposeVector for expression of SpCas9-Zif268 in yeast after assembly with PID fragments: TEF1p-SpCas9::KanR-1xNLS-3xHA-1xNLS-Zif268-1xNLS-CYC1t (KanR cassette in place of the PID)DepositorInsertTEF1p-SpCas9::KanR(in place of PID)-1xNLS-3xHA-1xNLS-Zif268-1xNLS-CYC1t
UseCRISPRTags3x HA, SV40 NLS, Zif268, and c-Myc-like NLSExpressionYeastMutationCorrected homology relative to wild type SpCas9 (…PromoterTEF1Available sinceApril 21, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCMV-T7-ABE8.20m-nSpG-P2A-EGFP (KAC1160)
Plasmid#185916PurposepCMV and pT7 plasmid encoding human codon optimized ABE8.20m A-to-G base editor with nickase SpG(D10A/D1135L/S1136W/G1218K/E1219Q/R1335Q/T1337R) and P2A-EGFPDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInserthuman codon optimized ABE8.20m-nSpG-P2A-EGFP
UseIn vitro transcription; t7 promoterTagsBPNLS and BPNLS-3xFLAG-P2A-EGFPExpressionMammalianMutationnSpG=D10A/D1135L/S1136W/G1218K/E1219Q/R1335Q/T133…PromoterCMV and T7Available sinceJuly 20, 2022AvailabilityAcademic Institutions and Nonprofits only