We narrowed to 10,117 results for: Uty
-
Plasmid#165121Purposemammalian expression and localizationDepositorAvailable SinceFeb. 10, 2021AvailabilityAcademic Institutions and Nonprofits only
-
APEX2 - Actin in pEGFP
Plasmid#66172PurposeAPEX2 fused to the N-terminus of human beta actinDepositorInsertAPEX2 - human beta Actin (ACTB Human, Synthetic)
TagsFlag epitope tag (DYKDDDDK)ExpressionMammalianMutationAPEX2 contains 4 mutations relative to wt soybean…PromoterCMVAvailable SinceJuly 21, 2015AvailabilityAcademic Institutions and Nonprofits only -
pTP434
Plasmid#104167PurposeBacterial expression plasmid of anti-GFP nanobody with 3x Cysteines for maleimide labelingDepositorInsertAnti-GFP nanobody Enhancer PDB 3K1K (3x Cysteine)
Tags14x Histidine tag and NEDD8 from Brachypodium dis…ExpressionBacterialMutation3x Cysteines located at bps 493-495, 520-522, and…Available SinceNov. 6, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-TRC.mKO2_shGFP
Plasmid#110318PurposeControl (Target CAAGCTGACCCTGAAGTTCAT), silence GFP and express monomeric Kusabira-Orange2DepositorInsertGFP
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceAug. 13, 2018AvailabilityAcademic Institutions and Nonprofits only -
GB1-A11(2-196, D40G)-Strep
Plasmid#196210PurposeCodon-optimized bacterial expression plasmid. Expresses GB1-His6-TEV-A11(2-196, D40G)-Strep.DepositorInsertAnnexin A11 (ANXA11 Human)
TagsGB1-6xHis-TEV and Strep-II tagExpressionBacterialMutationD40GAvailable SinceJuly 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
AAV pCAG-mRuby3-WPRE
Plasmid#107744PurposeCan be used to express mRuby3. Can also be used to create adeno-associated virus for delivery of the mRuby3 sequence.DepositorInsertmRuby3
UseAAVExpressionMammalianPromoterCAGAvailable SinceMarch 29, 2018AvailabilityAcademic Institutions and Nonprofits only -
pENTR-AmCyan
Plasmid#138481PurposeFor cloning sgRNA flanked by two ribozyme elements, to subsequently cloned into PL-5LTR-GW-A vector.DepositorInsertAmCyan
ExpressionMammalianAvailable SinceMarch 23, 2020AvailabilityAcademic Institutions and Nonprofits only -
pMEXneo-TrkB
Plasmid#190203PurposeTo express the Human TrkB receptor under the Moloney mouse sarcoma virus LTRDepositorAvailable SinceSept. 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
-
pRK5-myc-Miro2 A13V
Plasmid#47896PurposeExpresses myc tagged Miro2 A13V constitutively active mutantDepositorInsertMiro2 A13V (RHOT2 Human)
TagsmycExpressionMammalianMutationA13V, constitutively active mutantPromoterCMVAvailable SinceSept. 12, 2013AvailabilityAcademic Institutions and Nonprofits only -
GB1-A11(2-196, G38R)-Strep
Plasmid#196209PurposeCodon-optimized bacterial expression plasmid. Expresses GB1-His6-TEV-A11(2-196, G38R)-Strep.DepositorInsertAnnexin A11 (ANXA11 Human)
TagsGB1-6xHis-TEV and Strep-II tagExpressionBacterialMutationG38RAvailable SinceJuly 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
AAVS1-Puro-CAG-fl-STOP-fl-ZEB2-GFP-Flag-WPRE-poly(A)
Plasmid#165456PurposeInducible ZEB2 expression from AAVS1 locusDepositorAvailable SinceJune 17, 2021AvailabilityAcademic Institutions and Nonprofits only -
pNCST-AvicFP4
Plasmid#129507PurposeExpresses AvicFP4 constitutively in E. coli (most strains)DepositorInsertAvicFP4
ExpressionBacterialMutationOne of two variants of AvicFP4 tested with essent…Promotersynthetic constitutive (stationary phase) promote…Available SinceFeb. 19, 2020AvailabilityAcademic Institutions and Nonprofits only -
pDYT001
Plasmid#186549PurposeLineage tracing vector (with barcoded Target Sites and triple sgRNAs)DepositorInsert14-bp random integration barcode and three target sites and 3x sgRNAs
UseCRISPR and Synthetic BiologyExpressionMammalianPromoterEF1alphaAvailable SinceAug. 1, 2023AvailabilityAcademic Institutions and Nonprofits only -
Human USP7_H456A-3X FLAG
Plasmid#225335PurposeLentiviral expression of human mutant USP7 with 3x FLAG tag in mammalian cellsDepositorInsertUSP7 (USP7 Human)
UseLentiviralTags3xFLAGExpressionMammalianMutationH456APromoterEF1aAvailable SinceSept. 4, 2024AvailabilityAcademic Institutions and Nonprofits only -
pFastBac1 human full-length CENP-E-mNeon-6xHis
Plasmid#180484PurposepFastBac1 human CENP-E-mNeon-His, containing a 3c protease cleavage site between mNeon and His tag. Codon optimized for expression in Sf9 cellsDepositorInsertCENP-E (CENPE Human, human, Synthetic)
TagsmNeon-6xHisExpressionInsectPromoterpolyhedrin promoterAvailable SinceOct. 3, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSEMS-Tom20-mEGFP-reHaloTagF
Plasmid#200190PurposeTom20 with reversible HaloTagF variant for fluorescent labelingDepositorAvailable SinceJuly 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
Kif5A-CIBN
Plasmid#102251PurposeExpresses fusion of kinesin heavy chain 5A (1-572) and CIB1 (1-170)DepositorAvailable SinceNov. 21, 2017AvailabilityAcademic Institutions and Nonprofits only -
Sec61β-Flag-APEX2-SOPP3
Plasmid#229072PurposeExpresse APEX2-SOPP3 in ER in mammalian cellDepositorAvailable SinceFeb. 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
CD3-2A_pMI-LO
Plasmid#153418PurposeRetroviral (MSCV) expression of all four WT CD3 subunits, co-expressed with LSSmOrangeDepositorInsertmurine CD3 delta-gamma-epsilon-zeta subunits (Cd3d Mouse)
UseRetroviralExpressionMammalianAvailable SinceJuly 21, 2020AvailabilityAcademic Institutions and Nonprofits only