We narrowed to 14,045 results for: crispr grnas
-
Plasmid#162987PurposesgRNA cloning plasmidDepositorInsertexchangeable cassette
UseCRISPRExpressionBacterial and MammalianPromoterU6Available SinceSept. 21, 2021AvailabilityAcademic Institutions and Nonprofits only -
pX459-HypaCas9-AAVS1_sgRNA
Plasmid#183891PurposepX459V2.0-HypaCas9 plasmid with sgRNA targeting the AAVS1 in human cells.DepositorAvailable SinceMay 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
pU6-PspCas13b-GEMSgRNA2
Plasmid#204768PurposepU6-PspCas13b-gRNA-Actb1216 backbone (Addgene ID: 155368) containing guide RNA #2 targeting the GEMS m6A reporter mRNA sequence.DepositorInsertguide RNA targeting GEMS m6A sensor mRNA
UseCRISPRExpressionMammalianPromoterU6Available SinceJan. 2, 2024AvailabilityAcademic Institutions and Nonprofits only -
7i sgRNA for 4-μHOM reporter
Plasmid#113626PurposesgRNA/CAS9 expression plasmid to induce a 3’ double-strand break in the 4-μHOM reporter 8 nts. upstream from the microhomologyDepositorInsert7i sgRNA
UseCRISPRExpressionMammalianAvailable SinceAug. 13, 2018AvailabilityAcademic Institutions and Nonprofits only -
7h sgRNA for 4-μHOM reporter
Plasmid#113625PurposesgRNA/CAS9 expression plasmid to induce a 3’ double-strand break in the 4-μHOM reporter at the edge of the microhomology.DepositorInsert7h sgRNA
UseCRISPRExpressionMammalianAvailable SinceAug. 13, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAT9679-sgRNA-BFP
Plasmid#162988PurposesgRNA cloning plasmidDepositorInsertexchangeable cassette
UseCRISPRExpressionBacterial and MammalianPromoterU6Available SinceSept. 21, 2021AvailabilityAcademic Institutions and Nonprofits only -
pX330 EGFR-sgRNA
Plasmid#188633PurposeA human codon-optimized SpCas9 and chimeric guide RNA targeting C-terminus of human EGFRDepositorInserthumanized S. pyogenes Cas9
UseCRISPRTags3xFLAGExpressionMammalianPromoterCBhAvailable SinceAug. 16, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCfB9336 (pgRNA_II-1_NatMX)
Plasmid#161589PurposeEasyClone-MarkerFree guiding RNA vector to direct Cas9 to cut at site II-1DepositorInsertguiding RNA
UseCRISPR and Synthetic BiologyExpressionYeastAvailable SinceAug. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
px459-RhebL1 sgRNA
Plasmid#133769PurposeExpresses Cas9 and human RhebL1 sgRNADepositorInsertRhebL1 sgRNA
UseCRISPRExpressionMammalianPromoterU6Available SinceNov. 26, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCfB9337 (pgRNA_IV-1_NatMX)
Plasmid#161590PurposeEasyClone-MarkerFree guiding RNA vector to direct Cas9 to cut at site IV-1DepositorInsertguiding RNA
UseCRISPR and Synthetic BiologyExpressionYeastAvailable SinceAug. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA1-for-dSERT
Plasmid#221830PurposePlasmid to express gRNA1 (cgaaatctgcgctctacttg) for editing at the beginning of Drosophila SERT coding frameDepositorAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA2-for-dSERT
Plasmid#221831PurposePlasmid to express gRNA2 (gggattcgagcggcccgtcg) for editing at the beginning of Drosophila SERT coding frameDepositorAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCfB9339 (pgRNA_VII-1_NatMX)
Plasmid#161591PurposeEasyClone-MarkerFree guiding RNA vector to direct Cas9 to cut at site VII-1DepositorInsertguiding RNA
UseCRISPR and Synthetic BiologyExpressionYeastAvailable SinceAug. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCfB9340 (pgRNA_VIII-1_NatMX)
Plasmid#161592PurposeEasyClone-MarkerFree guiding RNA vector to direct Cas9 to cut at site VIII-1DepositorInsertguiding RNA
UseCRISPR and Synthetic BiologyExpressionYeastAvailable SinceAug. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCfB9341 (pgRNA_IX-1_NatMX)
Plasmid#161593PurposeEasyClone-MarkerFree guiding RNA vector to direct Cas9 to cut at site IX-1DepositorInsertguiding RNA
UseCRISPR and Synthetic BiologyExpressionYeastAvailable SinceAug. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCfB9342 (pgRNA_XIII-1_NatMX)
Plasmid#161594PurposeEasyClone-MarkerFree guiding RNA vector to direct Cas9 to cut at site XIII-1DepositorInsertguiding RNA
UseCRISPR and Synthetic BiologyExpressionYeastAvailable SinceAug. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCfB9343 (pgRNA_XV-1_NatMX)
Plasmid#161595PurposeEasyClone-MarkerFree guiding RNA vector to direct Cas9 to cut at site XV-1DepositorInsertguiding RNA
UseCRISPR and Synthetic BiologyExpressionYeastAvailable SinceAug. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCfB9344 (pgRNA_XVI-1_NatMX)
Plasmid#161596PurposeEasyClone-MarkerFree guiding RNA vector to direct Cas9 to cut at site XVI-1DepositorInsertguiding RNA
UseCRISPR and Synthetic BiologyExpressionYeastAvailable SinceAug. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
px459-Pole4 KO sgRNA
Plasmid#186935PurposePole4 KO in mouse ES cellsDepositorAvailable SinceAug. 5, 2022AvailabilityAcademic Institutions and Nonprofits only -
px459-Pole3 KO sgRNA
Plasmid#186934PurposePole3 KO in mouse ES cellsDepositorAvailable SinceAug. 5, 2022AvailabilityAcademic Institutions and Nonprofits only