We narrowed to 2,170 results for: Xpa
-
Plasmid#158013PurposeExpression vector for the de novo designed protein Expression_vector_RO1_8DepositorInsertde novo designed protein RO1_8
Tags6x His tagExpressionBacterialAvailabilityAcademic Institutions and Nonprofits only -
Expression_vector_RO1_9
Plasmid#158014PurposeExpression vector for the de novo designed protein Expression_vector_RO1_9DepositorInsertde novo designed protein RO1_9
Tags6x His tagExpressionBacterialAvailabilityAcademic Institutions and Nonprofits only -
Expression_vector_RO2_1
Plasmid#158015PurposeExpression vector for the de novo designed protein Expression_vector_RO2_1DepositorInsertde novo designed protein RO2_1
Tags6x His tagExpressionBacterialAvailabilityAcademic Institutions and Nonprofits only -
Expression_vector_RO2_5
Plasmid#158016PurposeExpression vector for the de novo designed protein Expression_vector_RO2_5DepositorInsertde novo designed protein RO2_5
Tags6x His tagExpressionBacterialAvailabilityAcademic Institutions and Nonprofits only -
Expression_vector_RO2_6
Plasmid#158017PurposeExpression vector for the de novo designed protein Expression_vector_RO2_6DepositorInsertde novo designed protein RO2_6
Tags6x His tagExpressionBacterialAvailabilityAcademic Institutions and Nonprofits only -
Expression_vector_RO2_9
Plasmid#158018PurposeExpression vector for the de novo designed protein Expression_vector_RO2_9DepositorInsertde novo designed protein RO2_9
Tags6x His tagExpressionBacterialAvailabilityAcademic Institutions and Nonprofits only -
Expression_vector_RO2_10
Plasmid#158019PurposeExpression vector for the de novo designed protein Expression_vector_RO2_10DepositorInsertde novo designed protein RO2_10
Tags6x His tagExpressionBacterialAvailabilityAcademic Institutions and Nonprofits only -
Expression_vector_RO2_15
Plasmid#158020PurposeExpression vector for the de novo designed protein Expression_vector_RO2_15DepositorInsertde novo designed protein RO2_15
Tags6x His tagExpressionBacterialAvailabilityAcademic Institutions and Nonprofits only -
Expression_vector_RO2_20
Plasmid#158021PurposeExpression vector for the de novo designed protein Expression_vector_RO2_20DepositorInsertde novo designed protein RO2_20
Tags6x His tagExpressionBacterialAvailabilityAcademic Institutions and Nonprofits only -
Expression_vector_RO2_25
Plasmid#158022PurposeExpression vector for the de novo designed protein Expression_vector_RO2_25DepositorInsertde novo designed protein RO2_25
Tags6x His tagExpressionBacterialAvailabilityAcademic Institutions and Nonprofits only -
Expression_vector_NT_1
Plasmid#158023PurposeExpression vector for the de novo designed protein Expression_vector_NT_1DepositorInsertde novo designed protein NT_1
Tags6x His tagExpressionBacterialAvailabilityAcademic Institutions and Nonprofits only -
Expression_vector_NT_8
Plasmid#158024PurposeExpression vector for the de novo designed protein Expression_vector_NT_8DepositorInsertde novo designed protein NT_8
Tags6x His tagExpressionBacterialAvailabilityAcademic Institutions and Nonprofits only -
Expression_vector_NT_9
Plasmid#158025PurposeExpression vector for the de novo designed protein Expression_vector_NT_9DepositorInsertde novo designed protein NT_9
Tags6x His tagExpressionBacterialAvailabilityAcademic Institutions and Nonprofits only -
Expression_vector_NT_10
Plasmid#158026PurposeExpression vector for the de novo designed protein Expression_vector_NT_10DepositorInsertde novo designed protein NT_10
Tags6x His tagExpressionBacterialAvailabilityAcademic Institutions and Nonprofits only -
pMS114
Plasmid#215677PurposeEmpty repair plasmid for ChrI split hygromycinR landing padDepositorInsert5'HA + MCS + loxN + rps-0p::5'ΔHygR
UseCRISPR and Cre/LoxExpressionWormMutation5' ∆HYGR encodes aa1-226Available SinceMarch 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMS59
Plasmid#215680PurposeCas9 + guide plasmid targeting ChrI split hygromycinR landing padDepositorInserteef-1A.1p::Cas9 + U6p::GTTTGAGTAGAGCACTCAGG
UseCRISPRExpressionWormAvailable SinceMarch 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMS158
Plasmid#215679PurposeEmpty repair plasmid for ChrIII split hygromycinR landing padDepositorInsert5'HA + MCS + lox2272 + rps-0p::5'ΔHygR
UseCRISPR and Cre/LoxExpressionWormMutation5' ∆HYGR encodes aa1-226Available SinceMarch 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMS77
Plasmid#215681PurposeCas9 + guide plasmid targeting ChrIII split hygromycinR landing padDepositorInserteef-1A.1p::Cas9 + U6p::GTCCAGCGGCAGATCGGCGG
UseCRISPRExpressionWormAvailable SinceMarch 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pTXTL-T7max-RLuc
Plasmid#188312PurposeExpression of Renilla luciferase via a T7 promoter in TXTLDepositorInsertRenilla luciferase
UseLuciferase and Synthetic BiologyTags8x His-tagExpressionBacterialPromoterT7MaxAvailable SinceAug. 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pEC2861 (pSpy1C-PgyrA_ffluc)
Plasmid#218511Purposereplicative E. coli-S. pyogenes shuttle plasmid, constitutive expression of firefly luciferase reporterDepositorInsertffluc
UseLuciferaseMutationdeletion of Plac_mrfp cassettePromoterPgyrAAvailable SinceSept. 3, 2024AvailabilityAcademic Institutions and Nonprofits only