We narrowed to 8,093 results for: gnal
-
Plasmid#99690PurposeExpresses dSa Cas9 fused to optimized combination of truncated activation domains from SCP1 promoter with dual snRP1 poly adenylation signal, and Sa sgRNA for Actc1, vector allows for strong activation of mouse Actc1, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Actc1 (gRNA sequence: GCCATTCTTGGAGCCAAGGG ) (Actc1 Synthetic, Mouse)
UseAAV and CRISPRTagsVPR miniExpressionMutationdead Cas9PromoterAvailable sinceSept. 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-STAT3mts
Plasmid#195577PurposeExpresses STAT3 with mitochondrial targeting sequenceDepositorInsertSignal transducer and activator of transcription 3 (Stat3 Mouse)
UseAAVTagsCox8 presequenceExpressionMammalianMutationPromoterCMV enhancer and promoterAvailable sinceFeb. 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLKO_HA.NWS.VSVg_NGFR
Plasmid#158243PurposeProtein Barcode (Pro-Code) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables phenotypic CRISPR screens at a single cell resolution (using cytometry).DepositorInsertPro-Code Tagged human dNGFR (NGFR Human)
UseCRISPR and LentiviralTagsHA.NWS.VSVgExpressionMutationTruncation of the signaling domainPromoterEF1aAvailable sinceSept. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLKO_HA.FLAG.VSVg_NGFR
Plasmid#158245PurposeProtein Barcode (Pro-Code) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables phenotypic CRISPR screens at a single cell resolution (using cytometry).DepositorInsertPro-Code Tagged human dNGFR (NGFR Human)
UseCRISPR and LentiviralTagsHA.FLAG.VSVgExpressionMutationTruncation of the signaling domainPromoterEF1aAvailable sinceSept. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLKO_NWS.FLAG.VSVg_NGFR
Plasmid#158233PurposeProtein Barcode (Pro-Code) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables phenotypic CRISPR screens at a single cell resolution (using cytometry).DepositorInsertPro-Code Tagged human dNGFR (NGFR Human)
UseCRISPR and LentiviralTagsNWS.FLAG.VSVgExpressionMutationTruncation of the signaling domainPromoterEF1aAvailable sinceSept. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
p2K7bsdUBI-mCherry-STIM1
Plasmid#114178PurposeLentiviral vector for expression of mCherry-STIM1DepositorInsertSTIM1 (STIM1 Human)
UseLentiviralTagsmCherry (inserted after signal peptide)ExpressionMammalianMutationPromoterUbiquitinAvailable sinceSept. 7, 2018AvailabilityAcademic Institutions and Nonprofits only -
pENTR1a-mCherry-STIM1
Plasmid#114176PurposeGateway entry clone containing mCherry-STIM1DepositorInsertSTIM1 (STIM1 Human)
UseGateway entry cloneTagsmCherry (inserted after signal peptide)ExpressionMutationPromoterAvailable sinceSept. 7, 2018AvailabilityAcademic Institutions and Nonprofits only -
pOT_4 - lenti-EFS-FMC6.3-BBz-2A-puro-2A-LTBR
Plasmid#181973PurposeExpresses anti-CD19 CAR (with 4-1BB signaling domain) linked to puromycin resistance via P2A and to human LTBR via T2A for lentiviral delivery.DepositorInsertFMC6.3-BBz CAR; LTBR (LTBR Synthetic, Human)
UseLentiviralTagsExpressionMutationPromoterAvailable sinceApril 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCEP4-myc-EFNB2 (D62Q-Q130L-V167L)
Plasmid#200977PurposeMammalian expression plasmid for myc-tagged EFNB2 (D62Q-Q130L-V167L specificity mutant)DepositorInsertEFNB2 (EFNB2 Human)
UseTagsExtracellular c-myc epitope tag and Signal peptid…ExpressionMammalianMutationD62Q-Q130L-V167L (increase specificity towards he…PromoterCMVAvailable sinceOct. 2, 2023AvailabilityAcademic Institutions and Nonprofits only -
pOT_3 - lenti-EFS-FMC6.3-28z-2A-puro-2A-LTBR
Plasmid#181972PurposeExpresses anti-CD19 CAR (with CD28 signaling domain) linked to puromycin resistance via P2A and to human LTBR via T2A for lentiviral delivery.DepositorInsertFMC6.3-28z CAR; LTBR (LTBR Synthetic, Human)
UseLentiviralTagsExpressionMutationPromoterAvailable sinceApril 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLKO_S.NWS.VSVg_NGFR
Plasmid#158348PurposeProtein Barcode (Pro-Code) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables phenotypic CRISPR screens at a single cell resolution (using cytometry).DepositorInsertPro-Code Tagged human dNGFR (NGFR Human)
UseCRISPR and LentiviralTagsS.NWS.VSVgExpressionMutationTruncation of the signaling domainPromoterEF1aAvailable sinceSept. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pNUT N6His Y95F/Y188F/Y426F/Y517F hTFNG hTFNG
Plasmid#70085PurposeExpresses N-His tagged nonglycosylated human serum transferrin unable to bind iron in either the N-lobe or the C-lobeN-lobeDepositorInsertmutated human serum transferrin (TF Human)
UseTagsHexa His tag and N-terminal signal peptide, 4 aa …ExpressionMammalianMutationAsn413 Asp, Asn611Asp, Tyr95Phe, Tyr188Phe, Ty426…PromoterSV40Available sinceNov. 10, 2015AvailabilityAcademic Institutions and Nonprofits only -
pAAV-STAT3
Plasmid#195575PurposeExpresses STAT3DepositorInsertSignal transducer and activator of transcription 3 (Stat3 Mouse)
UseAAVTagsExpressionMammalianMutationPromoterCMV enhancer and promoterAvailable sinceFeb. 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EF1α-FLEX-rc[Chronos-GFP]
Plasmid#62725PurposeAAV-mediated expression of Chronos-GFP under the EF1α promoter, in floxed/reversed (Cre-dependent) manner. Using bGHpA signal.DepositorInsertChronos-GFP
UseAAVTagsGFPExpressionMammalianMutationPromoterEF1αAvailable sinceApril 30, 2015AvailabilityAcademic Institutions and Nonprofits only -
pLKO_FLAG.Ollas.VSVg_NGFR
Plasmid#158324PurposeProtein Barcode (Pro-Code) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables phenotypic CRISPR screens at a single cell resolution (using cytometry).DepositorInsertPro-Code Tagged human dNGFR (NGFR Human)
UseCRISPR and LentiviralTagsFLAG.Ollas.VSVgExpressionMutationTruncation of the signaling domainPromoterEF1aAvailable sinceSept. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CNTF-HA
Plasmid#195517PurposeExpresses HA-tagged CNTF in mammalian cellsDepositorInsertCiliary neurotrophic factor (CNTF Human)
UseAAVTagsHA-tag and NGF signal peptideExpressionMammalianMutationPromoterUbC promoter with beta-globin intronAvailable sinceFeb. 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
pTT3-SP-6xHis-ISLR2(FL)-FLAG
Plasmid#157626PurposeMammalian cell surface expression of His- and FLAG-tagged full-length protein for binding and signaling assaysDepositorInsertISLR2 (ISLR2 Human)
UseTags6xHis and FLAGExpressionMammalianMutationPromoterCMVAvailable sinceJan. 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
mVenus-proα2(I)-G610C
Plasmid#119839PurposeExpresses mouse Type I procollagen α2 chain (Col1a2) with Gly610Cys mutation and mVenus between signal sequence and exon 6DepositorInsertType I procollagen α2 chain (Col1a2 Mouse)
UseTagsmVenusExpressionMammalianMutationCol1a2 exons 2-5 replaced by fluorescent tag, Gly…PromoterCMVAvailable sinceJan. 28, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLKO_S.FLAG.VSVg_NGFR
Plasmid#158345PurposeProtein Barcode (Pro-Code) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables phenotypic CRISPR screens at a single cell resolution (using cytometry).DepositorInsertPro-Code Tagged human dNGFR (NGFR Human)
UseCRISPR and LentiviralTagsS.FLAG.VSVgExpressionMutationTruncation of the signaling domainPromoterEF1aAvailable sinceSept. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLKO_HSV.FLAG.HA_NGFR
Plasmid#158294PurposeProtein Barcode (Pro-Code) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables phenotypic CRISPR screens at a single cell resolution (using cytometry).DepositorInsertPro-Code Tagged human dNGFR (NGFR Human)
UseCRISPR and LentiviralTagsHSV.FLAG.HAExpressionMutationTruncation of the signaling domainPromoterEF1aAvailable sinceSept. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLKO_HA.NWS.V5_NGFR
Plasmid#158248PurposeProtein Barcode (Pro-Code) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables phenotypic CRISPR screens at a single cell resolution (using cytometry).DepositorInsertPro-Code Tagged human dNGFR (NGFR Human)
UseCRISPR and LentiviralTagsHA.NWS.V5ExpressionMutationTruncation of the signaling domainPromoterEF1aAvailable sinceSept. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLKO_HA.NWS.FLAG_NGFR
Plasmid#158249PurposeProtein Barcode (Pro-Code) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables phenotypic CRISPR screens at a single cell resolution (using cytometry).DepositorInsertPro-Code Tagged human dNGFR (NGFR Human)
UseCRISPR and LentiviralTagsHA.NWS.FLAGExpressionMutationTruncation of the signaling domainPromoterEF1aAvailable sinceSept. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pMT-HGP-v3-NbVHH05-hIgG
Plasmid#171565PurposeExpresses hIgG-tagged anti-UBC6e (human) recombinant alpaca nanobody (NbVHH05-human IgG-TEV-Avi-His) in fly cellsDepositorInsertNbVHH05-human IgG-TEV-Avi-His (UBE2J1 Human)
UseTagsBiP signal peptide and hIgG1-hinge-N297A-TEV site…ExpressionInsectMutationPromoterAvailable sinceJune 29, 2021AvailabilityAcademic Institutions and Nonprofits only -
mCerulean-proα2(I)-G610C
Plasmid#119837PurposeExpresses mouse Type I procollagen α2 chain (Col1a2) with Gly610Cys mutation and mCerulean between signal sequence and exon 6DepositorInsertType I procollagen α2 chain (Col1a2 Mouse)
UseTagsmCeruleanExpressionMammalianMutationCol1a2 exons 2-5 replaced by fluorescent tag, Gly…PromoterCMVAvailable sinceJan. 29, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLKO_S.C.V5_NGFR
Plasmid#158331PurposeProtein Barcode (Pro-Code) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables phenotypic CRISPR screens at a single cell resolution (using cytometry).DepositorInsertPro-Code Tagged human dNGFR (NGFR Human)
UseCRISPR and LentiviralTagsS.C.V5ExpressionMutationTruncation of the signaling domainPromoterEF1aAvailable sinceSept. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EF1α1.1-Chronos-GFP
Plasmid#122098PurposeAAV-mediated expression of Chronos-GFP under the EF1α promoter (1.1kb short version). Using SV40 pA signal.DepositorInsertChronos-GFP
UseAAVTagsGFPExpressionMammalianMutationPromoterEF1α (1.1 kb short version)Available sinceAug. 21, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCJ199
Plasmid#162672PurposepET-21b(+) based plasmid for expression of the putative MHET hydrolase from Comamonas thiooxydans (Genbank WP_080747404.1) with C-terminal His tag, codon optimized for expression in E. coli K12.DepositorInsertPutative MHET hydrolase from Comamonas thiooxydans (Genbank WP_080747404.1) with signal peptide
UseTagsHisExpressionBacterialMutationcodon optimized for expression in E. coli K12PromoterT7/lacAvailable sinceJan. 7, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLKO_HSV.Ollas.FLAG_NGFR
Plasmid#158270PurposeProtein Barcode (Pro-Code) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables phenotypic CRISPR screens at a single cell resolution (using cytometry).DepositorInsertPro-Code Tagged human dNGFR (NGFR Human)
UseCRISPR and LentiviralTagsHSV.Ollas.FLAGExpressionMutationTruncation of the signaling domainPromoterEF1aAvailable sinceSept. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
mApple-proα2(I)-G610C
Plasmid#119841PurposeExpresses mouse Type I procollagen α2 chain (Col1a2) with Gly610Cys mutation and mApple between signal sequence and exon 6DepositorInsertType I procollagen α2 chain (Col1a2 Mouse)
UseTagsmAppleExpressionMammalianMutationCol1a2 exons 2-5 replaced by fluorescent tag, Gly…PromoterCMVAvailable sinceJan. 28, 2019AvailabilityAcademic Institutions and Nonprofits only -
pEAHISPApqsE
Plasmid#97019PurposeExpressing Pseudomonas aeruginosa pqsE proteinDepositorInsertQuinolone signal response protein
UseTagsN-ter TEV protease cleavable 6HIsExpressionMutationnonePromoterT7Available sinceAug. 16, 2017AvailabilityAcademic Institutions and Nonprofits only