We narrowed to 8,410 results for: reporter
-
Plasmid#60804PurposeLuciferase reporter to measure miR-155 mediated differential repression. Contains PELO 3' UTR and wild-type miR-155 sitesDepositorInsertPELO 3'UTR and wild-type miR-155 binding site (PELO Human)
UseLuciferaseExpressionMammalianPromoterthymidine kinase (HSV-TK promoter)Available SinceOct. 20, 2014AvailabilityAcademic Institutions and Nonprofits only -
pEMS1210
Plasmid#29107PurposeExpression of the eGFP reporter gene was not detected in the brain and eye.DepositorAvailable SinceNov. 4, 2011AvailabilityAcademic Institutions and Nonprofits only -
pMiR-RECK-3'UTR-miR-7-mut
Plasmid#53692PurposeLuciferase reporter assay for RECK 3'UTR that has point mutations on miR-7 binding siteDepositorInsertRECK-3'UTR (RECK Human)
UseLuciferaseMutationnucleotide position 171-174 are mutated to GAAGAvailable SinceJuly 22, 2014AvailabilityAcademic Institutions and Nonprofits only -
pIS1 EPAS1
Plasmid#60792PurposeLuciferase reporter to measure miR-155 mediated differential repression. Contains EPAS1 3' UTR and wild-type miR-155 sitesDepositorInsertEPAS1 3'UTR and wild-type miR-155 binding site (EPAS1 Human)
UseLuciferaseExpressionMammalianPromoterthymidine kinase (HSV-TK promoter)Available SinceOct. 20, 2014AvailabilityAcademic Institutions and Nonprofits only -
pEMS1136
Plasmid#29056PurposeExpression of the eGFP reporter gene was not detected in the brain and eye.DepositorAvailable SinceNov. 16, 2011AvailabilityAcademic Institutions and Nonprofits only -
(203-bp-DIAL-YB_TATA)-mCherry-HRasG12V-BGH_pKG2744
Plasmid#246340Purpose203-bp DIAL Reporter Plasmid with YB_TATA expressing mCherry-GS-HRasG12V in the presence of ZFa and editable by Cre recombinaseDepositorAvailable SinceNov. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCAGGS-Rox-nlsKate5V-stop-Rox-myr-Flag-BFP-NEO (JDW 473)
Plasmid#242587PurposeA CAGGS driven, Dre recombinase dependent switch reporter (nls-mKate2 to MbBFP following Dre recombination).DepositorInsertnlsKateV5, MbBPF-FLAG, FRTNeoFRT
ExpressionMammalianPromoterCAGGSAvailable SinceSept. 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
MB 45t3 thsS(t3)R-sfGFP_mCherry
Plasmid#232470PurposeOptimized thiosulfate sensor with fluorescent reporter (GFP), constitutive mCherryDepositorInsertsthsS(t3)
thsR
PphsA342
sfGFP
AxeTxe
mCherry
ExpressionBacterialMutationContains the following mutations K286Q, Q350H, I…PromoterJ23100 (TTGACGGCTAGCTCAGTCCTAGGTACAGTGCTAGC), J23…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
Mirror GFP[ENE(WT)-mascRNA(mut 8356-8370)](pAVA3874)
Plasmid#239353PurposeExpresses TEV protease and tandemly-repeated GFP fluorescent proteins to amplify the fluorescence signal produced by a single transcription unit of MALAT1 ENE(WT)-mascRNA(mut 8356-8370) reporter.DepositorInsertMALAT1 ENE(WT)-mascRNA(mut 8356-8370)
ExpressionMammalianMutationMALAT1 ENE(WT)-mascRNA(mut 8356-8370: ctacgaccacc…Available SinceAug. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
Mirror GFP[ENE(C8351G)-mascRNA(mut 8356-8370)](pAVA3871)
Plasmid#239352PurposeExpresses TEV protease and tandemly-repeated GFP fluorescent proteins to amplify the fluorescence signal produced by a single transcription unit of MALAT1 ENE(C8351G)-mascRNA(mut 8356-8370) reporter.DepositorInsertMALAT1 ENE(C8351G)-mascRNA(mut 8356-8370)
ExpressionMammalianMutationMALAT1 ENE(C8351G)-mascRNA(mut 8356-8370: ctacgac…Available SinceAug. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
MSCV-BRAF-V600E-IRES-mCherry
Plasmid#221026PurposeFluorescent reporter for expressing a segment of BRAF-V600E CDSDepositorAvailable SinceAug. 13, 2025AvailabilityAcademic Institutions and Nonprofits only -
MSCV-BRAF-WT-IRES-mCherry
Plasmid#221027PurposeFluorescent reporter for expressing a segment of wild type BRAFDepositorAvailable SinceAug. 13, 2025AvailabilityAcademic Institutions and Nonprofits only -
pSA358_pAAV-SCP1-Intron-eGFP-CS1
Plasmid#215513PurposeSingle stranded AAV eGFP reporter vector with SCP1 promoter.DepositorInserteGFP
UseAAVExpressionMammalianPromoterSCP1Available SinceAug. 12, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn1-DIO-ExRai-AKAR2-T/A
Plasmid#171847PurposeCre-dependent, synapsin promoter-driven expression of the negative control phosphomutant ExRai-AKAR2 T/A PKA biosensor in neurons.DepositorInsertExRai-AKAR2 T/A
UseAAVExpressionMammalianMutationT6A phospho-deficient mutationPromoterhSyn1Available SinceJuly 15, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-ITR-CMV-mCherry-1xU6-LeuIGI1
Plasmid#217367PurposeExpresses E. coli leucine tRNA variant "LeuIGI1" and a wild-type mCherry reporter; can be packaged into AAVDepositorInsertE. coli leucine tRNA mutant, "LeuIGI1" for TAG suppression
UseAAVExpressionMammalianMutationG6U, C78G, U83CPromoterU6Available SinceJuly 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-ITR-CMV-mCherry-1xU6-LeuIGI2
Plasmid#217368PurposeExpresses E. coli leucine tRNA variant "LeuIGI2" and a wild-type mCherry reporter; can be packaged into AAVDepositorInsertE. coli leucine tRNA mutant, "LeuIGI2" for TAG suppression
UseAAVExpressionMammalianMutationC2G, C3G, G6U, A7G, U77C, C78G, G81C, G82C, U83CPromoterU6Available SinceJuly 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pENTR-FLAG-HAND1-T2A-mTagBFP2
Plasmid#223192PurposeEntry vector containing FLAG-HAND1 with a T2A-mTagBFP2 reporter (attL flanked)DepositorInsertHAND1 (HAND1 Human)
UsePromoterless entry vector for gateway cloningTagsFLAG and T2A-mTagBFP2ExpressionBacterialPromoterNoneAvailable SinceApril 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCAGEN-Luciferase-P2A-H2A-mCherry (JDW 1129)
Plasmid#229823PurposeA CAGGS driven luciferase reporter followed by a P2A cleavage peptide and an H2A mCherry cassette for nuclear labeling.DepositorInsertLuciferase-P2A-H2A-mCherry
ExpressionMammalianAvailable SinceFeb. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pB-Tet-Off_FLEX_Luc-P2A-H2A-mCherry (JDW 970)
Plasmid#229824PurposeA PiggyBac vector with a cre-dependent dual luciferase / nuclear mCherry reporter. In the presence of cre, this tet-off vector will be ubiquitously expressed in the absence of dox/tetDepositorInsertLuciferase-P2A-H2A-mCherry
ExpressionMammalianAvailable SinceFeb. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pB-Tet-On-Luciferase-P2A-H2A-mCherry (JDW 1154)
Plasmid#229840PurposeA Piggybac compatible, tet-on, dual reporter encoding luciferase followed by a P2A cleavage peptide and then an H2A fused mCherry for nuclear labeling.DepositorInsertLuciferase
ExpressionMammalianAvailable SinceFeb. 13, 2025AvailabilityAcademic Institutions and Nonprofits only -
pcDNA4TO T21R-F8.2 (S54L+T127A)-T2A-mCherry
Plasmid#225584PurposeMammalian expression vector for Doxycycline inducible expression of TRIM21 RING-F8.2(S54L+T127A) anti-tau degrader with a self-cleaving T2A-mCherry fluorescent expression reporterDepositorInsertT21R-F8.2 (S54L+T127A)-T2A-mCherry
TagsmCherryExpressionMammalianMutationT21R-F8.2 (S54L+T127A)PromoterCMVAvailable SinceFeb. 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
HIV-1-GFP ΔEnv CA E45A
Plasmid#217438PurposeHIV-1 reporter vector that is env-deficient and expresses eGFP in place of nef; contains 5' and 3' LTRs, gag, pol, tat, and rev, but does not express vif, vpr, or vpu (with E45A mutation in CA).DepositorInsertgag/pol
UseLentiviralMutationCA E45AAvailable SinceJan. 28, 2025AvailabilityAcademic Institutions and Nonprofits only -
HIV-1-GFP ΔEnv CA Q63/67A
Plasmid#217439PurposeHIV-1 reporter vector that is env-deficient and expresses eGFP in place of nef; contains 5' and 3' LTRs, gag, pol, tat, and rev, but does not express vif, vpr, or vpu (with Q63A,Q67A mutations in CA).DepositorInsertgag/pol
UseLentiviralMutationCA Q63A,Q67AAvailable SinceJan. 28, 2025AvailabilityAcademic Institutions and Nonprofits only -
HIV-1-GFP ΔEnv CA M66I
Plasmid#217440PurposeHIV-1 reporter vector that is env-deficient and expresses eGFP in place of nef; contains 5' and 3' LTRs, gag, pol, tat, and rev, but does not express vif, vpr, or vpu (with M66I mutation in CA).DepositorInsertgag/pol
UseLentiviralMutationCA M66IAvailable SinceJan. 28, 2025AvailabilityAcademic Institutions and Nonprofits only -
HIV-1-GFP ΔEnv CA Q67H/N74D
Plasmid#217441PurposeHIV-1 reporter vector that is env-deficient and expresses eGFP in place of nef. Contains 5' and 3' LTRs, gag, pol, tat, and rev, but does not express vif, vpr, or vpu (with Q67H,N74D mutations in CA).DepositorInsertgag/pol
UseLentiviralMutationCA Q67H,N74DAvailable SinceJan. 28, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCS2+ GFP-CDK5R1 degron (283-307)-IRES-mCherry
Plasmid#231008PurposeProtein stability reporter construct for CDK5R1 consisting of aa 283-307 for transient overexpression in mammalian cells.DepositorAvailable SinceJan. 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
pME-H2B-V5-n2StayGoldC4 (JDW 1354)
Plasmid#224486PurposeGateway compatible middle entry clone contianing Histone H2B fusion to V5-tagged (n2)StayGold(C4) (Nuclear StayGold fluorescent reporter)DepositorInsertH2B-V5-n2StayGoldC4
UseGateway cloningAvailable SinceSept. 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
pME V5 mScarlet-I (JDW 1323)
Plasmid#224487PurposeGateway compatible middle entry clone containing V5 tagged m-Scarlet-I (Cytosolic far red fluorescent reporter)DepositorInsertV5-mScarlet-I
UseGateway cloningAvailable SinceSept. 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
mTph2p(330bp)-Luc
Plasmid#223663PurposeFirefly-luciferase reporter expression driven by proximal 330-bp of mouse Tph2 promoterDepositorInsertmTph2 promoter (Tph2 Mouse)
UseLuciferaseTagsFirefly luciferaseExpressionMammalianPromotermTph2 promoterAvailable SinceSept. 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
mTph2p(330bp)-mut1-Luc
Plasmid#223664PurposeFirefly-luciferase reporter expression driven by proximal 330-bp of mouse Tph2 promoter point mutation at RRE site 1DepositorInsertmTph2 promoter (Tph2 Mouse)
UseLuciferaseTagsFirefly luciferaseExpressionMammalianPromotermTph2 promoterAvailable SinceSept. 11, 2024AvailabilityAcademic Institutions and Nonprofits only