We narrowed to 10,841 results for: esp
-
-
pXD71Cas10.0-Pct5.1-crRNA(AarI)
Plasmid#191633PurposeE. coli - Eggerthella lenta shuttle plasmid (KanR), cumate-inducible promoter Pct5.1-crRNA(nontargeting spacer), entry plasmid for crRNA cloningDepositorInsertCymR
UseCRISPRExpressionBacterialAvailable SinceJan. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
Immunostealth
Plasmid#239446PurposeExpresses murine NIS (mNIS) in mammalian cells for non-immunogenic in vivo imaging using SPECT or PETDepositorAvailable SinceJune 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
pGK-HELLO LV
Plasmid#202001PurposeExpresses HELLO neoantigen in tumor cellsDepositorInsertHELLO
UseLentiviralTagsFLAGPromoterpGKAvailable SinceAug. 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLVX-RNaseHI-NES-EGFP
Plasmid#196701PurposePlasmid for stable expression of wild type bacterial RNase HI tagged with NES and EGFP that can be used to specifically degrade the DNA-RNA hybrids in the cytoplasm.DepositorInsertbacterial RNaseHI
UseLentiviralAvailable SinceMarch 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
trLATmEos3.2
Plasmid#203745PurposeEncodes the transmembrane domain from human LAT with mEos3.2 fused on the C terminus. Used as a fluorescent plasma membrane probe.DepositorAvailable SinceAug. 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLenti HRE-Luc pGK Hygro
Plasmid#118706Purposereporter plasmid HIF-responsive promoter (3xHRE) wt- fused to firefly luciferaseDepositorInsertHRE (HIF-responsive promoter (3xHRE)-luc
UseLentiviralAvailable SinceNov. 26, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn1-eYFP
Plasmid#117382PurposeAn AAV genome that expresses the fluorescent protein eYFP from the hSyn1 promoterDepositorHas ServiceAAV PHP.eB, AAV Retrograde, AAV1, AAV2, AAV5, AAV8, and AAV9InsertEYFP
UseAAVExpressionMammalianPromoterhSyn1Available SinceOct. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLGB36
Plasmid#135621PurposeSuicide vector for allelic replacement in Bacteroides species including B. fragilis strain 638R, erythromycin selection and aTC-inducible ss-Bfe3 counterselectionDepositorInsertbfe3
UseBacteroides suicide vector with inducible counter…Tagssignal sequence for periplasmic targetingPromoterBacteroides promoter regualted by TetR transcript…Available SinceJan. 22, 2020AvailabilityAcademic Institutions and Nonprofits only -
pMOD_C2517
Plasmid#91086PurposeModule C, Promoter: TaU3, Gene: Esp3I ccdb cassette for single gRNA spacer cloning (+ BaeI site for GT donor cloning), Terminator: Pol IIIDepositorInsertEsp3I ccdb cassette for single gRNA spacer cloning (+ BaeI site for GT donor cloning)
UseCRISPRPromoterTaU3Available SinceJuly 14, 2017AvailabilityAcademic Institutions and Nonprofits only -
pcDNA-HDAC6.ΔBuz-FLAG
Plasmid#30484DepositorInsertHDAC6 (HDAC6 Human)
TagsFLAGExpressionMammalianMutationDeletion of the C-terminal Ubiquitin binding doma…Available SinceSept. 6, 2011AvailabilityAcademic Institutions and Nonprofits only -
pJJiaDEST-APEX2-GAL9
Plasmid#149520PurposeExpress APEX2-Galectin-9 in mammalian cellsDepositorAvailable SinceDec. 15, 2020AvailabilityAcademic Institutions and Nonprofits only -
RelA cFlag pcDNA3
Plasmid#20012DepositorAvailable SinceJan. 28, 2009AvailabilityAcademic Institutions and Nonprofits only -
pZR043_Lenti-U6-sgEGFR-MS2-PP7-hPGK-PCP-p65-HSF1-Puro
Plasmid#180267PurposeLentiviral expression vector for CRISPRa-SAM with EGFR targeting sgRNADepositorInsertEGFR sgRNA
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceFeb. 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
pcDNA Flag Yap1
Plasmid#18881DepositorAvailable SinceAug. 14, 2008AvailabilityAcademic Institutions and Nonprofits only -
pJRH-1345 U6-B2M sgRNA Gag-Cas9 v2
Plasmid#201916PurposeCas9-EDV production plasmid. Expresses the v2 Gag-Cas9 polypeptide (CAG promoter) and B2M sgRNA (human U6 promoter, 5’-GAGTAGCGCGAGCACAGCTA)DepositorInsertsGag-Cas9 v2
B2M sgRNA (Target-specific sequence: 5'- GAGTAGCGCGAGCACAGCTA)
ExpressionMammalianPromoterCAG and Human U6Available SinceAug. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
pet28a-His6-Halo-TEV-Nrf2
Plasmid#62455PurposeHalo-His6 tagged Nrf2 for E.coli expressionDepositorAvailable SinceApril 6, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCDNAIIIB rhoA QL
Plasmid#61632Purposemammalian expression of rhoA constitutively active mutantDepositorAvailable SinceJan. 26, 2015AvailabilityAcademic Institutions and Nonprofits only -
pDblet
Plasmid#8848DepositorInsertARS doublet
UseYeast cloning vectorExpressionYeastMutationThis vector contains, between AatII sites, a dire…Available SinceApril 20, 2006AvailabilityAcademic Institutions and Nonprofits only -
Nrf1-Myc pcDNA3.1(+)-C-Myc
Plasmid#169125Purposeexpression of proteinDepositorAvailable SinceMay 13, 2021AvailabilityAcademic Institutions and Nonprofits only