We narrowed to 5,790 results for: SPI;
-
Plasmid#196618PurposeExpresses SARS-CoV-2 RBD protein from the BQ.1.1 variant with single chain Fc, HRV3C protease cleavage site, and AVI tagDepositorInsertSARS-CoV-2-RBD-BQ.1.1
TagsAVI, HRV3C, and scFcExpressionMammalianMutationG339D, R346T, S371F, S373P, S375F, T376A, D405N, …Available SinceFeb. 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLEX307_CR-PDHA2S293A
Plasmid#115204PurposeLentiviral transduction and expression of CRISPR/Cas9-resistant PDHA2S293A into any mammalian cell (when using sgRNA 5'-ATGTAATGACGTGATCCGAG-3')DepositorInsertCR (CRISPR/Cas9-resistant)-PDHA2S293A (PDHA2 Human)
UseLentiviralMutationc.321C>T (silent when translated to protein, c…PromoterEF1alphaAvailable SinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLEX307_CR-PDHA2S291A/S293A
Plasmid#115205PurposeLentiviral transduction and expression of CRISPR/Cas9-resistant PDHA2S291A/S293A into any mammalian cell (when using sgRNA 5'-ATGTAATGACGTGATCCGAG-3')DepositorInsertCR (CRISPR/Cas9-resistant)-PDHA2S291A/S293A (PDHA2 Human)
UseLentiviralMutationc.321C>T (silent when translated to protein, c…PromoterEF1alphaAvailable SinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLD-puro-Cc-CR-PARK7WT-VA
Plasmid#115187PurposeLentiviral transduction and expression of CRISPR/Cas9-resistant PARK7WT into any mammalian cell (when using sgRNA seq agtacagtgtagccgtgatg)DepositorInsertCR (CRISPR/Cas9-resistant)-PARK7WT (PARK7 Human)
UseLentiviralTagsVersatile affinity tag (2XStreptactin II-6XHis-3X…Mutationc.150G>A (silent when translated to protein, c…PromoterCMVAvailable SinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLD-puro-Cc-CR-PARK7V51G-VA
Plasmid#115188PurposeLentiviral transduction and expression of CRISPR/Cas9-resistant PARK7V51G into any mammalian cell (when using sgRNA seq agtacagtgtagccgtgatg)DepositorInsertCR (CRISPR/Cas9-resistant)-PARK7V51G (PARK7 Human)
UseLentiviralTagsVersatile affinity tag (2XStreptactin II-6XHis-3X…Mutationc.150G>A (silent when translated to protein, c…PromoterCMVAvailable SinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLD-puro-Cc-CR-PARK7C53A-VA
Plasmid#115189PurposeLentiviral transduction and expression of CRISPR/Cas9-resistant PARK7C53A into any mammalian cell (when using sgRNA seq agtacagtgtagccgtgatg)DepositorInsertCR (CRISPR/Cas9-resistant)-PARK7C53A (PARK7 Human)
UseLentiviralTagsVersatile affinity tag (2XStreptactin II-6XHis-3X…Mutationc.150G>A (silent when translated to protein, c…PromoterCMVAvailable SinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLD-puro-Cc-CR-PARK7H126A-VA
Plasmid#115190PurposeLentiviral transduction and expression of CRISPR/Cas9-resistant PARK7H126A into any mammalian cell (when using sgRNA seq agtacagtgtagccgtgatg)DepositorInsertCR (CRISPR/Cas9-resistant)-PARK7H126A (PARK7 Human)
UseLentiviralTagsVersatile affinity tag (2XStreptactin II-6XHis-3X…Mutationc.150G>A (silent when translated to protein, c…PromoterCMVAvailable SinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLD-puro-Cc-CR-PARK7E163K-VA
Plasmid#115191PurposeLentiviral transduction and expression of CRISPR/Cas9-resistant PARK7E163K into any mammalian cell (when using sgRNA seq agtacagtgtagccgtgatg)DepositorInsertCR (CRISPR/Cas9-resistant)-PARK7E163K (PARK7 Human)
UseLentiviralTagsVersatile affinity tag (2XStreptactin II-6XHis-3X…Mutationc.150G>A (silent when translated to protein, c…PromoterCMVAvailable SinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLEX307_CR-PDHA2
Plasmid#115199PurposeLentiviral transduction and expression of a CRISPR/Cas9-resistant PDHA2 into any mammalian cell (when using sgRNA 5'-ATGTAATGACGTGATCCGAG-3')DepositorInsertCR (CRISPR/Cas9-resistant)-PDHA2WT (PDHA2 Human)
UseLentiviralMutationc.321C>T (silent when translated to protein, c…PromoterEF1alphaAvailable SinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLEX307_CR-PDHA2S291A
Plasmid#115203PurposeLentiviral transduction and expression of CRISPR/Cas9-resistant PDHA2S291A into any mammalian cell (when using sgRNA 5'-ATGTAATGACGTGATCCGAG-3')DepositorInsertCR (CRISPR/Cas9-resistant)-PDHA2S291A (PDHA2 Human)
UseLentiviralMutationc.321C>T (silent when translated to protein, c…PromoterEF1alphaAvailable SinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLT3REVIR_MARK3 2573
Plasmid#107233PurposeshRNA 2573. Do not use Evos or Acurri on these cells. Assess by FACS specifically with Venus and DsRed lazers. Tet-ON-all-in-oneDepositorAvailable SinceMarch 28, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLT3REVIR_MARK3 1122
Plasmid#107232PurposeshRNA 1122. Do not use Evos or Acurri on these cells. Assess by FACS specifically with Venus and DsRed lazers. Tet-ON-all-in-oneDepositorAvailable SinceMarch 28, 2018AvailabilityAcademic Institutions and Nonprofits only -
hNTa1-qgRNA-pYJA5
Plasmid#217779PurposeNon-targeting control 1 qgRNA-pYJA5 plasmid from the T.gonfio library; it can be used as a ready-to-go control and provides the three constant regions for the three-fragment PCRs for qgRNA cloningDepositorInsertQuadruple sgRNA-expression cassette for nontargeting control for gene activation and epigenetic silencing
UseCRISPR, Lentiviral, and Synthetic BiologyExpressionMammalianPromoterhuman U6, mouse U6, human H1, human 7SKAvailable SinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pVRC8400-SARS-CoV-2-RBD-SD1-AVI
Plasmid#160477PurposeExpresses SARS-CoV-2 RBD-SD1 domain with single chain Fc, HRV3C protease cleavage site, and AVI tagDepositorInsertSARS-CoV-2-RBD-SD1
TagsAVI, HRV3C, and scFcExpressionMammalianAvailable SinceOct. 14, 2020AvailabilityAcademic Institutions and Nonprofits only -
pVRC8400-SARS-CoV-2-RBD-AVI
Plasmid#160476PurposeExpresses SARS-CoV-2 RBD domain with single chain Fc, HRV3C protease cleavage site, and AVI tagDepositorInsertSARS-CoV-2-RBD
TagsAVI, HRV3C, and scFcExpressionMammalianAvailable SinceOct. 14, 2020AvailabilityAcademic Institutions and Nonprofits only -
pUCM-CLYBL-NGN2-BRN3A
Plasmid#165597PurposeDonor construct for insertion of NGN2 and BRN3A into the CLYBL safe harbor site. This is an all-in-one doxycycline-inducible construct, enabling iPSC differentiation into peripheral sensory neurons.DepositorInsertsUseCRISPR and TALENExpressionMammalianPromoterCAG, EF-1alpha, Endogenous CLYBL (splice acceptor…Available SinceMarch 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pVRC8400-SARS-CoV-2-NTD-AVI
Plasmid#160475PurposeExpresses SARS-CoV-2 NTD domain with single chain Fc, HRV3C protease cleavage site, and AVI tagDepositorInsertSARS-CoV-2-NTD
TagsAVI, HRV3C, and scFcExpressionMammalianAvailable SinceOct. 14, 2020AvailabilityAcademic Institutions and Nonprofits only -
hNTa2-qgRNA-pYJA5
Plasmid#217780PurposeNon-targeting control 2 qgRNA-pYJA5 plasmid from the T.gonfio library; it can be used as a ready-to-go control and provides the three constant regions for the three-fragment PCRs for qgRNA cloningDepositorInsertQuadruple sgRNA-expression cassette for nontargeting control for gene activation and epigenetic silencing
UseCRISPR, Lentiviral, and Synthetic BiologyExpressionMammalianPromoterhuman U6, mouse U6, human H1, human 7SKAvailable SinceApril 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRK5-mEGFP-DVL1-WT
Plasmid#194586PurposeMammalian Expression of mEGFP-DVL1 WT Fusion ProteinDepositorAvailable SinceFeb. 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCMV-T7-TadCBEd-SpCas9(LWKYQS)-P2A-EGFP (BKS1014)
Plasmid#223127PurposepCMV and pT7 Human expression plasmid for TadCBEd using SpCas9 CBE enzyme with LWKYQS amino acids at positions 1135,1136,1218,1219,1335,T1337 with C-term BPNLS-P2A-EGFPDepositorInserthuman codon optimized TadA-CDd-SpCas9(LWKYQS)-2xUGI-P2A-EGFP
UseCRISPRTags2xUGI-BPNLS-P2A-EGFP and BPNLS-TadA-CDdExpressionMammalianMutationTadA-CDd mutations; nSpCas9(D10A/LWKYQS)=D1135L, …PromoterCMV and T7Available SinceApril 23, 2025AvailabilityAcademic Institutions and Nonprofits only