We narrowed to 11,210 results for: nar
-
Plasmid#226442PurposeFor subcloning of human EXOC3 promoter (base pairs -1701 to -1594) or for assays using M13 phageDepositorAvailable SinceJuly 14, 2025AvailabilityAcademic Institutions and Nonprofits only
-
TOPO-EXOC3 (-1592 to -1444)
Plasmid#226445PurposeFor subcloning of human EXOC3 promoter (base pairs -1592 to -1444) or for assays using M13 phageDepositorAvailable SinceJuly 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
TOPO-EXOC3 (-1557 to-1444)
Plasmid#226447PurposeFor subcloning of human EXOC3 promoter (base pairs -1557 to-1444) or for assays using M13 phageDepositorAvailable SinceJuly 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCDH-EF1a-eFFly-mCherry
Plasmid#104833Purpose3rd generation lentiviral vector. eFFly luciferase for in vivo Imaging, mCherry for fluorescent detectionDepositorInsertseFFly
mCherry
UseLentiviral and LuciferaseExpressionMammalianAvailable SinceAug. 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pDEST-N2H-N1
Plasmid#125547PurposeGateway compatible N2H assay destination vector with N-terminus tagging of nanoluc fragment1DepositorTypeEmpty backboneUseIn vitro expressionTagsNanoLuc fragment1 attached to n-terminus of Gatew…ExpressionBacterial and MammalianPromotersynthetic promoter containing yeast, mammalian, a…Available SinceAug. 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
pDEST-N2H-C1
Plasmid#125549PurposeGateway compatible N2H assay destination vector with C-terminus tagging of nanoluc fragment1DepositorTypeEmpty backboneUseIn vitro expressionTagsNanoLuc fragment1 attached to c-terminus of Gatew…ExpressionMammalian and YeastPromotersynthetic promoter containing yeast, mammalian, a…Available SinceAug. 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
pDEST-N2H-C2
Plasmid#125559PurposeGateway compatible N2H assay destination vector with C-terminus tagging of nanoluc fragment2DepositorTypeEmpty backboneUseIn vitro expressionTagsNanoLuc fragment2 attached to c-terminus of Gatew…ExpressionMammalian and YeastPromotersynthetic promoter containing yeast, mammalian, a…Available SinceAug. 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
pDEST-N2H-N2
Plasmid#125548PurposeGateway compatible N2H assay destination vector with N-terminus tagging of nanoluc fragment2DepositorTypeEmpty backboneUseIn vitro expressionTagsNanoLuc fragment2 attached to n-terminus of Gatew…ExpressionMammalian and YeastPromotersynthetic promoter containing yeast, mammalian, a…Available SinceAug. 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLVX MLKL(S345D)-2A-mCherry-puro
Plasmid#231975PurposeTet inducible expression of DmrB-Mlkl with mCherry to induce phosphomimetic MLKL S345D necroptosisDepositorInsertMLKL S345D construct with bi-cistronic mCherry (Mlkl Mouse)
UseLentiviralMutationMLKL S345DAvailable SinceFeb. 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLVX MLKL(1-180)-2A-mCherry-puro
Plasmid#231976PurposeTet inducible expression of DmrB-Mlkl with mCherry to induce MLKL 1-180 necroptosisDepositorInsertMLKL 1-180 construct with bi-cistronic mCherry (Mlkl Mouse)
UseLentiviralAvailable SinceFeb. 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
AAV phSyn1(S)-FLEX-tdTomato-T2A-SypEGFP-WPRE
Plasmid#51509PurposeCan be used to generate AAV virus that will express cytoplasmic tdTomato and presynaptic (synaptophysin-fused) EGFP in the presence of Cre in neurons from the synapsin promoterDepositorHas ServiceAAV1InserttdTomato-T2A-SypEGFP
UseAAVPromoterphSyn1Available SinceMay 2, 2014AvailabilityAcademic Institutions and Nonprofits only -
pCDNA3.1 hSCN5AdeltaSIV GFP Nter
Plasmid#145770Purposeexpresses human Nav1.5 lacking the SIV motif and tagged with GFP at its N-terminus in mammalian cellsDepositorInsertsodium voltage-gated channel alpha subunit 5 (SCN5A Human)
TagsGFPExpressionMammalianMutationStop codon at Serine 2013PromoterCMVAvailable SinceOct. 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
pDONR223_PRKCA_WT
Plasmid#82225PurposeGateway Donor vector containing PRKCA , part of the Target Accelerator Plasmid Collection.DepositorAvailable SinceApril 24, 2017AvailabilityAcademic Institutions and Nonprofits only -
pDONR223_PTEN_WT
Plasmid#81737PurposeGateway Donor vector containing PTEN , part of the Target Accelerator Plasmid Collection.DepositorAvailable SinceApril 24, 2017AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1 FFSS-BACH1
Plasmid#232273PurposeExpression of N-terminal tagged 2xFLAG-2xSTREP-BACH1 (H. sapiens) in human cell linesDepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCMV-hERalpha
Plasmid#101141PurposeMammalian expression of full-length human estrogen receptor-alphaDepositorAvailable SinceSept. 6, 2017AvailabilityAcademic Institutions and Nonprofits only -
pT3TS-zSpG
Plasmid#179316PurposeIn vitro transcription of SpG-Cas9 mRNA zebrafish codon-optimized from T3 promoterDepositorInsertZebrafish codon-optimized Cas9 variant SpG
UseCRISPR; In vitro transcription by t3 promoterTagsSV40-NLSMutationSpG=D1135L/S1136W/G1218K/E1219Q/ R1335Q/T1337RAvailable SinceMay 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pT3TS-zSpRY
Plasmid#179317PurposeIn vitro transcription of SpRY-Cas9 mRNA zebrafish codon-optimized from T3 promoterDepositorInsertZebrafish codon-optimized Cas9 variant SpRY
UseCRISPR; In vitro transcription by t3 promoterTagsSV40-NLSMutationSpRY=A61R/L1111R/D1135L/S1136W/G1218K/E1219Q/ N13…Available SinceMay 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EF1a-iCreV
Plasmid#140135PurposeCan be used to generate AAV virus that will express light-inducible site-specific iCreV recombinaseDepositorHas ServiceAAV PHP.eB and AAV1InsertiCreV
UseAAV and Cre/LoxExpressionMammalianPromoterEF1alphaAvailable SinceApril 23, 2020AvailabilityAcademic Institutions and Nonprofits only -
pDONR223_VHL_WT
Plasmid#81874PurposeGateway Donor vector containing VHL , part of the Target Accelerator Plasmid Collection.DepositorAvailable SinceApril 24, 2017AvailabilityAcademic Institutions and Nonprofits only -
ssAAV-EF1a-FLuc-WPRE-HgHpA_bac_293
Plasmid#118412PurposeExpresses firefly luciferase under the control of a strong ubiquitous promoter EF1a along with a WPRE cassette. Backbone is compatible with both baculoviral and human production methods of AAV.DepositorInsertFirefly luciferase
UseAAV, Luciferase, and Synthetic BiologyExpressionInsect and MammalianPromoterEF1aAvailable SinceNov. 20, 2019AvailabilityAcademic Institutions and Nonprofits only -
pcDNA-EGFP MASTL G44S (siRNA resistant)
Plasmid#191012PurposeExpresses EGFP-tagged kinase-dead MASTL G44S with resistance to MASTL siRNA (ACGCCTTATTCTAGCAAATTA)DepositorInsertMicrotubule-associated serine/threonine kinase like (MASTL Human)
TagsEGFPExpressionMammalianMutationG44SAvailable SinceNov. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pET28a-MH6-uvsY
Plasmid#163914PurposeExpresses uvsY for bacterial expression and affinity purificationDepositorAvailable SinceMarch 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSPL3-ABCC8-9-10
Plasmid#135918PurposeEncodes ABCC8 exons 9 and 10 wild type for the analysis of splicing variantsDepositorInsertATP-binding Cassette subfamily C member 8 (ABCC8 Human)
UseExon trappingExpressionMammalianPromoterSV40Available SinceMarch 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pHR-UCOE-SFFV-Zim3-dCas9-P2A-EGFP
Plasmid#188899PurposedCas9 with an N-term Zim3 KRAB-NLS fusion, a C-term HA-2xNLS, and GFP linked by a P2A site from a SFFV promoter with an upstream ubiquitous chromatin opening elementDepositorInsertZim3-dCas9
UseLentiviralTagsHA-2xNLS, P2A-GFP, and Zim3 KRAB-NLS fusionPromoterSFFVAvailable SinceOct. 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
pcDNA-EGFP MASTL E167D (siRNA resistant)
Plasmid#191013PurposeExpresses EGFP-tagged MASTL with E167D mutation and resistance to MASTL siRNA (ACGCCTTATTCTAGCAAATTA)DepositorInsertMicrotubule-associated serine/threonine kinase like (MASTL Human)
TagsEGFPExpressionMammalianMutationE167DAvailable SinceNov. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pGP-AAV-syn-FLEX-jGCaMP8s-WPRE
Plasmid#162377PurposeAAV-mediated expression of ultrafast protein calcium sensor under the Syn promoter, Cre-dependent expressionDepositorHas ServiceAAV Retrograde, AAV1, and AAV9InsertjGCaMP8s
UseAAV and Cre/LoxTags6xHisExpressionMammalianMutationS26M F286Y Q315HPromoterSynapsinAvailable SinceNov. 30, 2020AvailabilityAcademic Institutions and Nonprofits only -
pET28a-MH6-Bsu
Plasmid#163911PurposeExpresses Bsu large fragment for affinity purificationDepositorInsertBsu polymerase
TagsHisExpressionBacterialPromoterT7 promoterAvailable SinceMarch 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDONR223_TRAF3_WT
Plasmid#81755PurposeGateway Donor vector containing TRAF3 , part of the Target Accelerator Plasmid Collection.DepositorAvailable SinceApril 24, 2017AvailabilityAcademic Institutions and Nonprofits only -
pGP-AAV-syn-FLEX-jGCaMP8f-WPRE
Plasmid#162379PurposeAAV-mediated expression of ultrafast protein calcium sensor under the Syn promoter, Cre-dependent expressionDepositorHas ServiceAAV Retrograde, AAV1, AAV5, and AAV9InsertjGCaMP8f
UseAAV and Cre/LoxTags6xHisExpressionMammalianMutationQ315LPromoterSynapsinAvailable SinceNov. 30, 2020AvailabilityAcademic Institutions and Nonprofits only