We narrowed to 30,481 results for: des.2
-
Plasmid#83369PurposePartner to pGAPTrap-TALEN1, for enhanced gene targeting of the human GAPDH locus using GAPTrap vectorsDepositorInsertGAPDH_TALEN2
ExpressionMammalianPromoterEF1alphaAvailable SinceOct. 21, 2016AvailabilityAcademic Institutions and Nonprofits only -
shMEK1/2 puro
Plasmid#72567PurposeHairpin targeting MEK1 and MEK2 (murine).DepositorAvailable SinceJuly 12, 2016AvailabilityAcademic Institutions and Nonprofits only -
pHH0103_BCL2L1_BH4+Bcl-2
Plasmid#109993PurposeProtein expression and purification of BCL2L1_BH4+Bcl-2DepositorInsertBCL2L1_BH4+Bcl-2 (BCL2L1 Human)
ExpressionBacterialAvailable SinceOct. 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-shNCLX-2
Plasmid#181871PurposeExpresses NCLX-targeted shRNA under control of the U6 promoter and mCherry under control of the CaMKIIa promoterDepositorInsertsolute carrier 8 family member B1 (Slc8b1 Mouse)
UseAAV, Adenoviral, and Mouse TargetingTagsmCherryExpressionMammalianPromoterU6Available SinceMarch 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
pHH0103_CRK-1/2
Plasmid#91367PurposeProtein expression and purification of human SH3 domain construct CRK-1/2DepositorInsertCRK-1/2 (CRK Human)
ExpressionBacterialAvailable SinceMarch 19, 2018AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPR-sgSHOC2-2
Plasmid#86129PurposeLentiviral vector expressing Cas9 and an sgRNA targeting SHOC2DepositorAvailable SinceMay 15, 2017AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPR-sgC1orf27-2
Plasmid#86131PurposeLentiviral vector expressing Cas9 and an sgRNA targeting C1orf27DepositorInsertsgRNA 2 targeting C1orf27 (C1orf27 )
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceFeb. 22, 2017AvailabilityAcademic Institutions and Nonprofits only -
pHH0103_CD2AP-2/3
Plasmid#91391PurposeProtein expression and purification of human SH3 domain construct CD2AP-2/3DepositorInsertCD2AP-2/3 (CD2AP Human)
ExpressionBacterialAvailable SinceMarch 19, 2018AvailabilityAcademic Institutions and Nonprofits only -
shMEK1/2 neo
Plasmid#72569PurposeHairpin targeting MEK1 and MEK2 (murine).DepositorAvailable SinceJuly 12, 2016AvailabilityAcademic Institutions and Nonprofits only -
pET-28a_VIM-2
Plasmid#242840PurposeExpresses His6-TEV-VIM-2 in bacteria, comprising a His6-tag, the Tobacco etch virus (TEV) cleavage site “ENLYFQ/G", and the VIM-2 sequence (UniPROT Q5U7L7)DepositorInsertMetallo-beta-lactamase VIM-2
TagsHis6 + Tobacco etch virus (TEV) cleavage site “EN…ExpressionBacterialMutationdeleted residues 1-26PromoterT7Available SinceSept. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
PX459_NRF2-exon5-2
Plasmid#177782PurposesgRNA for CRISPR/Cas9-mediated deletion of human NRF2DepositorInsertNRF2 (NFE2L2 Human)
UseCRISPRAvailable SinceAug. 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML104-HIS3-2
Plasmid#232881PurposePlasmid expressing Cas9 and gRNA CCAAGTTCGACAACTGCGTA which targets the HIS3 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML104-LEU2-2
Plasmid#232883PurposePlasmid expressing Cas9 and gRNA GGTAGTGTTAGACCTGAACA which targets the LEU2 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
LPUtopia-7_CoV-2
Plasmid#224782PurposeLanding Pad donor vector containing partial RdRp and N gene sequences from SARS-CoV-2 for fluorescent reporter assayDepositorAvailable SinceOct. 31, 2024AvailabilityAcademic Institutions and Nonprofits only -
pTCO2-mTDGi.2
Plasmid#149431PurposeminiTdg gene, SUMOylation mutantDepositorInsertTdg (Tdg Mouse)
UseCre/LoxExpressionMammalianMutationK341A SUMOylation mutant, SNPs of Tdg gene in OLA…PromoterTdg promoterAvailable SinceSept. 10, 2020AvailabilityAcademic Institutions and Nonprofits only -
pHH0103_FCHSD2-1/2
Plasmid#91444PurposeProtein expression and purification of human SH3 domain construct FCHSD2-1/2DepositorInsertFCHSD2-1/2 (FCHSD2 Human)
ExpressionBacterialAvailable SinceMarch 19, 2018AvailabilityAcademic Institutions and Nonprofits only -
pHH0103_FCHSD1-1/2
Plasmid#91449PurposeProtein expression and purification of human SH3 domain construct FCHSD1-1/2DepositorInsertFCHSD1-1/2 (FCHSD1 Human)
ExpressionBacterialAvailable SinceMarch 19, 2018AvailabilityAcademic Institutions and Nonprofits only -
pHH0103_TRIO-1/2
Plasmid#91353PurposeProtein expression and purification of human SH3 domain construct TRIO-1/2DepositorInsertTRIO-1/2 (TRIO Human)
ExpressionBacterialAvailable SinceMarch 19, 2018AvailabilityAcademic Institutions and Nonprofits only -
pHH0103_ARHGEF37-1/2
Plasmid#91310PurposeProtein expression and purification of human SH3 domain construct ARHGEF37-1/2DepositorInsertARHGEF37-1/2 (ARHGEF37 Human)
ExpressionBacterialAvailable SinceMarch 19, 2018AvailabilityAcademic Institutions and Nonprofits only -
pHH0103_CACNB2-1/2
Plasmid#91314PurposeProtein expression and purification of human SH3 domain construct CACNB2-1/2DepositorInsertCACNB2-1/2 (CACNB2 Human)
ExpressionBacterialAvailable SinceMarch 19, 2018AvailabilityAcademic Institutions and Nonprofits only