We narrowed to 1,542 results for: tetracycline resistance
-
Plasmid#71428PurposeThis E. coli DH10B strain harbors a shuttle vector plasmid that expresses the Mixed Feedback Loop version of the UBER system with a T7RNAP translation rate of 1535 and a TetR translation rate of 30709DepositorInsertMixed Feedback Loop version of the UBER system
MutationT7 RBS: AACCGAGCCCAATATAGGACCTAGGGTGCCAAAAAA and …Available SinceFeb. 19, 2016AvailabilityAcademic Institutions and Nonprofits only -
TERT - WT
Plasmid#213827PurposeExpresses human telomerase reverse transcriptase, the catalytic subunit of telomeraseDepositorInserthuman TERT (TERT Human)
UseLentiviralExpressionMammalianPromoterTet-responsive promoter PTight, consisting of sev…Available SinceFeb. 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCW-eGFP
Plasmid#162823PurposeDoxycycline-inducible overexpression of eGFPDepositorInserteGFP
UseLentiviralExpressionMammalianMutationV163APromoterTet ONAvailable SinceFeb. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCW-eGFP-SHLD1
Plasmid#114116PurposeLentiviral vector for inducible expression of N-terminally tagged eGFP-SHLD1DepositorInsertSHLD1 (SHLD1 Human)
UseLentiviral; Doxycycline inducibleTagseGFPExpressionMammalianPromoterTRE promoter, Tet ONAvailable SinceAug. 28, 2018AvailabilityIndustry, Academic Institutions, and Nonprofits -
pCW-eGFP-SHLD2
Plasmid#114119PurposeLentiviral vector for inducible expression of N-terminally tagged eGFP-SHLD2DepositorInsertSHLD2 (SHLD2 Human)
UseLentiviral; Doxycycline inducibleTagseGFPExpressionMammalianPromoterTRE promoter, Tet ONAvailable SinceAug. 28, 2018AvailabilityIndustry, Academic Institutions, and Nonprofits -
pBbS2k-RFP
Plasmid#35330DepositorInsertRFP
UseSynthetic BiologyExpressionBacterialPromoterTetAvailable SinceFeb. 20, 2012AvailabilityAcademic Institutions and Nonprofits only -
pBbA2k-RFP
Plasmid#35327DepositorInsertRFP
UseSynthetic BiologyExpressionBacterialPromoterTetAvailable SinceFeb. 17, 2012AvailabilityAcademic Institutions and Nonprofits only -
-
pLV-Puro-{CMV-CuO}>{MCS}:T2A:mCherry
Plasmid#236249PurposePuromycin selected lentiviral vector with MCS for cumate-inducible gene, for use with dual-inducible CymR-CuO systemDepositorTypeEmpty backboneUseLentiviralExpressionMammalianPromoterCMV-CuOAvailable SinceJune 12, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCD5-H1MI15-CO-GCN4-TEV-sfGFP-TS
Plasmid#158741PurposeExpresses influenza A virus trimeric hemagglutinin A/H1/MI/15 fused to a sfGFPDepositorInsertHemagglutinin A/MI/45/15 H1N1
TagsGCN4-TEV-sfGFP-TwinStrepExpressionMammalianMutationAA61-469PromoterCMVAvailable SinceNov. 18, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCW-GFP-CtIP-T847E
Plasmid#71111Purposemammalian expession of GFP-CtlP T847E mutationDepositorInsertCtlP
UseLentiviralTagsGFPExpressionMammalianMutationT847EPromoterTRE promoter, Tet ONAvailable SinceDec. 9, 2015AvailabilityIndustry, Academic Institutions, and Nonprofits -
mCHOP10.pCDNA1
Plasmid#21899DepositorInsertCHOP10 (Ddit3 Mouse)
ExpressionMammalianAvailable SinceSept. 10, 2009AvailabilityAcademic Institutions and Nonprofits only -
pDN-T1GZmbh
Plasmid#44522DepositorInsertsUseSynthetic Biology; Expression regulator/reporterExpressionYeastMutationThree tandem tet operators (3XtetO2) downstream o…PromoterPGal1-T123 promoterAvailable SinceApril 23, 2013AvailabilityAcademic Institutions and Nonprofits only -
pDN-G1GZmbh
Plasmid#44516DepositorInsertsUseSynthetic Biology; Expression regulator/reporterExpressionYeastMutationTwo tandem tet operators (2XtetO2) downstream of …PromoterPGal1-D12 promoterAvailable SinceApril 23, 2013AvailabilityAcademic Institutions and Nonprofits only -
pInducer10b-HA-KRAS G12V CO SR
Plasmid#164928PurposeExpresses HA tagged, codon Optimized and siRNA-resistant, tetracycline-inducible KRASG12V sequenceDepositorInsertKRAS proto-oncogene, GTPase (KRAS) (KRAS Human)
UseLentiviralTagsHA tagMutationGlycine 12 changed to valine; 9 Valine codons are…PromoterUbc promoterAvailable SinceMay 27, 2021AvailabilityAcademic Institutions and Nonprofits only -
pInducer10b-HA-KRAS WT CO SR
Plasmid#164926PurposeExpresses HA tagged, codon Optimized and siRNA-resistant, tetracycline-inducible KRAS wild type sequenceDepositorInsertKRAS proto-oncogene, GTPase (KRAS) (KRAS Human)
UseLentiviralTagsHA tagMutation9 Valine codons are optimized and siRNA targetin…PromoterUbc promoterAvailable SinceMay 27, 2021AvailabilityAcademic Institutions and Nonprofits only -
pMflET-o4
Plasmid#101314PurposeContains: complete oriC region of M. florum L1 (oriC4 fragment), colE1 rep origin, recoded tetM and ereB resistance genes, origin of transfer of RP4 plasmid.DepositorInsertsoriC4 of M. florum strain L1 (rpmH/dnaA and dnaA/dnaN intergenic regions, with dnaA)
ereB resistance gene
UseSynthetic BiologyExpressionBacterialAvailable SinceNov. 13, 2017AvailabilityAcademic Institutions and Nonprofits only -
p2B-58
Plasmid#177928PurposeExpresses yeGFP under control of doxycycline-responsive TET4 promoter (contains four rtTA binding sites)DepositorArticleInsertEGFP
ExpressionBacterial and YeastPromoterTET4 (contains four rtTA binding sites)Available SinceDec. 9, 2021AvailabilityAcademic Institutions and Nonprofits only -
pMEND-Lx
Plasmid#25010DepositorInsertpMEND-Lx
ExpressionBacterialAvailable SinceAug. 4, 2010AvailabilityAcademic Institutions and Nonprofits only -
pMflPT-o4
Plasmid#101315PurposeContains: complete oriC region of M. florum L1 (oriC4 fragment), colE1 rep origin, recoded tetM and pac resistance genes, origin of transfer of RP4 plasmid.DepositorInsertsoriC4 of M. florum strain L1 (rpmH/dnaA and dnaA/dnaN intergenic regions, with dnaA)
pac resistance gene
UseSynthetic BiologyExpressionBacterialAvailable SinceDec. 4, 2017AvailabilityAcademic Institutions and Nonprofits only