We narrowed to 13,833 results for: CRISPR-Cas9
-
Plasmid#183431PurposeCreOFF gRNA expression for beta3-tubulin (amino acid position: stop codon)DepositorInsertgRNA
UseCRISPRAvailable SinceApril 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
pOC2 GFP-Actb KI
Plasmid#183429PurposeCreOFF knock-in for GFP-beta-actin (amino acid position: before start codon)DepositorInsertgRNA and GFP donor
UseCRISPRAvailable SinceApril 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
pOC2 Gria1-GFP KI
Plasmid#183430PurposeCreOFF knock-in for GluA1-GFP (amino acid position: stop codon)DepositorInsertgRNA and GFP donor
UseCRISPRAvailable SinceApril 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAC-U63-tgRNA-Gal80
Plasmid#169030PurposegRNA-marker vector contain a U6:3 promoter, gRNA scaffold, and a Ubi-Gal80 marker.DepositorTypeEmpty backboneUseCRISPRExpressionInsectPromoterU6:3Available SinceJune 10, 2021AvailabilityAcademic Institutions and Nonprofits only -
sgiRFP1
Plasmid#113972PurposeSingle short guide RNA targeting GATCGAGTTCGAGCCTGCGG in iRFP670 sequenceDepositorInsertiRFP670 sgRNA
UseCRISPRExpressionMammalianPromoterU6Available SinceMarch 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
sgiRFP2
Plasmid#113973PurposeSingle short guide RNA targeting GCGCGTTCTTTGGACGCGA in iRFP670 sequenceDepositorInsertiRFP670 sgRNA
UseCRISPRExpressionMammalianPromoterU6Available SinceMarch 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
sgiRFP3
Plasmid#113974PurposeSingle short guide RNA targeting CGTGATGTTGTACCGCTTC in iRFP670 sequenceDepositorInsertiRFP670 sgRNA
UseCRISPRExpressionMammalianPromoterU6Available SinceMarch 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
pENTR-R4R3-mRuby-N
Plasmid#113752PurposeGateway multi-site entry clone for second position mRuby (N-terminal tag). Introduced into the genome via homology-directed repair after an LR reaction with homology sequences.DepositorInsertmRuby2
UseCRISPR; Gateway entry vectorTagsmRuby2Available SinceNov. 1, 2018AvailabilityAcademic Institutions and Nonprofits only -
pENTR-R4R3-2xmEGFP-N
Plasmid#113747PurposeGateway multi-site entry clone for second position 2x mEGFP (N-terminal tag). Introduced into the genome via homology-directed repair after an LR reaction with homology sequences.DepositorInsertmEGFP-mEGFP
UseCRISPR; Gateway entry vectorTags2xmEGFPAvailable SinceSept. 24, 2018AvailabilityAcademic Institutions and Nonprofits only -
pENTR-R4R3-3xmEGFP-N
Plasmid#113748PurposeGateway multi-site entry clone for second position 3x mEGFP (N-terminal tag). Introduced into the genome via homology-directed repair after an LR reaction with homology sequences.DepositorInsertmEGFP-mEGFP-mEGFP
UseCRISPR; Gateway entry vectorTags3xmEGFPAvailable SinceSept. 24, 2018AvailabilityAcademic Institutions and Nonprofits only -
pENTR-R4R3-2xmEGFP-C
Plasmid#113750PurposeGateway multi-site entry clone for second position 2x mEGFP (C-terminal tag). Introduced into the genome via homology-directed repair after an LR reaction with homology sequences.DepositorInsertmEGFP-mEGFP
UseCRISPR; Gateway entry vectorTags2xmEGFPAvailable SinceSept. 24, 2018AvailabilityAcademic Institutions and Nonprofits only -
pENTR-R4R3-2xmRuby-N
Plasmid#113753PurposeGateway multi-site entry clone for second position 2x mRuby (N-terminal tag). Introduced into the genome via homology-directed repair after an LR reaction with homology sequences.DepositorInsertmRuby2-mRuby2
UseCRISPR; Gateway entry vectorTags2xmRuby2Available SinceSept. 24, 2018AvailabilityAcademic Institutions and Nonprofits only -
pENTR-R4R3-2xmRuby-C
Plasmid#113756PurposeGateway multi-site entry clone for second position 2x mRuby (C-terminal tag). Introduced into the genome via homology-directed repair after an LR reaction with homology sequences.DepositorInsertmRuby2-mRuby2
UseCRISPR; Gateway entry vectorTags2xmRuby2Available SinceSept. 24, 2018AvailabilityAcademic Institutions and Nonprofits only -
pUDP082
Plasmid#103875PurposeBroad-host-range Cas9/gRNA co-expression plasmid with gRNA targetting ADE2 from Kluyveromyces marxianusDepositorInsertHH-gRNA-HDV targetting ADE2 in Kluyveromyces marxianus
UseCRISPRExpressionYeastPromoterScTDH3Available SinceJune 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
pUDP002
Plasmid#103872PurposeBroad-host-range Cas9/gRNA co-expression backbone plasmid (no gRNA)DepositorInsertshph
Spcas9 D147Y P411T
UseCRISPRTagsNLSExpressionYeastMutationD147Y P411TPromoterArxula adeninivorans TEF1 and Ashbya gossypii (Er…Available SinceJune 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
pUDP013
Plasmid#103873PurposeBroad-host-range Cas9/gRNA co-expression plasmid with gRNA targetting ADE2 from Ogataea (para)polymorphaDepositorInsertHH-gRNA-HDV targetting ADE2 in Ogataea (para)polymorpha
UseCRISPRExpressionYeastPromoterScTDH3Available SinceJune 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
pUDP025
Plasmid#103874PurposeBroad-host-range Cas9/gRNA co-expression plasmid with gRNA targetting ADE2 from Kluyveromyces lactisDepositorInsertHH-gRNA-HDV targetting ADE2 in Kluyveromyces lactis
UseCRISPRExpressionYeastPromoterScTDH3Available SinceJune 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCSD_FRB-TALETS3-3xFLAG-2xNLS
Plasmid#107306PurposeExpresses TALE-VEGFA-TS3 fused to FRB in mammalian cellsDepositorInsertTALE_VEGFA-TS3
UseCRISPRTags3x Flag, 2xNLS and FRBExpressionMammalianPromoterCMV IE94Available SinceNov. 15, 2018AvailabilityAcademic Institutions and Nonprofits only -
pBM019
Plasmid#128179PurposeConstruct for generating stable Cas9-expressing Toxoplasma gondiiDepositorInsertssgRNA#1
SpCas9
Chloramphenicol acetyltransferase
UseCRISPR; Toxoplasma gondii expressionTags3X FLAG and Nuclear Localization SignalPromoterTUB1 (Toxoplasma gondii), U6 (Toxoplasma gondii),…Available SinceJuly 10, 2019AvailabilityAcademic Institutions and Nonprofits only -
PX856
Plasmid#62888PurposeC-term SpCas9 piece of inducible transcriptional activator (dCas9(C)-FKBP-2xNLS-VP64)DepositorInsertSpCas9 (aa536-1368)
UseCRISPRTagsFKBP12, NLS, NLS SV40, and VP64ExpressionMammalianMutationAsparagine 863 to Alanine (N863A)PromoterCBhAvailable SinceMarch 16, 2015AvailabilityAcademic Institutions and Nonprofits only