We narrowed to 11,070 results for: AGA
-
Plasmid#25052DepositorAvailable SinceJune 29, 2010AvailabilityAcademic Institutions and Nonprofits only
-
p426_Cas9_gRNA-ARS308a
Plasmid#87384PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS308a sequence CACTTGTCAAACAGAATATA in yeast chromosome 3DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS308a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
RIPK1 gRNA (BRDN0001149147)
Plasmid#76535Purpose3rd generation lentiviral gRNA plasmid targeting human RIPK1DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pPB-TetON-mEGFP-NGN2_WT
Plasmid#215610PurposeFor integration of NGN2 WT T2A mEGFPDepositorAvailable SinceMarch 27, 2024AvailabilityAcademic Institutions and Nonprofits only -
CDK3 gRNA (BRDN0001147261)
Plasmid#76765Purpose3rd generation lentiviral gRNA plasmid targeting human CDK3DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pLCHKO_GFP_Luciferase
Plasmid#155079PurposeLentiviral plasmid for expressing U6 driven hybrid guide (hg)RNA targeting GFP and Luciferase using SpCas9 and LbCas12a nucleases (CHyMErA system), respectivelyDepositorInsert(hg)RNA targeting GFP and Luciferase using SpCas9 and LbCas12a nucleases
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceAug. 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCold I-Hero13
Plasmid#187929PurposeBacterial expression of heat-resistant obscure (Hero) protein Hero13DepositorAvailable SinceOct. 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-RSV-GFP-U6-Rosa26 gRNA (SpyCas9 scaffold)
Plasmid#120296PurposeAAV vector; encodes GFP as well as a U6-driven Rosa26-targeting gRNA (SpyCas9 scaffold)DepositorInsertRosa26 gRNA (SpCas9 scaffold)
UseAAV and CRISPRExpressionMammalianAvailable SinceJan. 25, 2019AvailabilityAcademic Institutions and Nonprofits only -
pET28-MRPP3-His
Plasmid#67866Purposebacterial expression of PRORP (KIAA0391), full coding sequence (mitoch. form) + C-term. His tagDepositorInsertMRPP3 (KIAA0391 Human)
TagsHisExpressionBacterialMutationAmino acid 46 of recombinant MRPP3 is preceded byβ¦PromoterT7Available SinceAug. 14, 2015AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-lincRNA-RoR-sh1 (Linc-sh1)
Plasmid#45764DepositorAvailable SinceAug. 12, 2013AvailabilityAcademic Institutions and Nonprofits only -
STARR-seq luciferase INF enhancer vector_ORI_IFI27
Plasmid#99320PurposeLuciferase validation vector with IFI27 enhancer inserted downstream of the reporter gene. The candidate's enhancer activity is reflected by luciferase activityDepositorInsertenhancer; chr14: 94575894-94578286
UseLuciferase; Starr-seq luciferase validation vectorExpressionMammalianAvailable SinceOct. 23, 2017AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgNotch2#2/Cre
Plasmid#193226PurposeLentiviral vector expressing Cre recombinase (driven by mPGK promoter) and an sgRNA against the mouse Notch2 geneDepositorAvailable SinceDec. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
Cas9_YTHDF2_sgRNA
Plasmid#186673PurposeYTHDF2 sgRNA plasmidDepositorInsertYTHDF2 KO sgRNA Plasmid (YTHDF2 Human)
ExpressionMammalianAvailable SinceAug. 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
SIK3 gRNA (BRDN0001144776)
Plasmid#75754Purpose3rd generation lentiviral gRNA plasmid targeting human SIK3DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pRRL.SIN.EF1A.JAG1-F1.218.CAR-2G
Plasmid#194459PurposeCAR featuring: GMCSF (sig. peptide); CD8A & CD8A (hinge & TM); 4-1BB & CD3ΞΆ (signaling domains); anti-JAG1 from J1.F1 in VL-VH order and 218 linker (scFv). GFP-Zeo for selection and monitoring.DepositorInsertAnti-JAG1 CAR
UseLentiviralAvailable SinceMarch 20, 2023AvailabilityAcademic Institutions and Nonprofits only -
STARR-seq luciferase validation vector_mP_SV40
Plasmid#99310PurposeLuciferase validation vector with SV40 enhancer inserted downstream of the reporter gene. The candidate's enhancer activity is reflected by luciferase activityDepositorInsertSV40 enhancer
UseLuciferase; Starr-seq luciferase validation vectorExpressionMammalianAvailable SinceSept. 26, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLL5.0 hCortKD-Flcortmut3YF EGFP
Plasmid#187263PurposeLentiviral expression of shRNA targeting Cortactin + reconstitution of Cortactin3YF mutantDepositorInsertCortactin (CTTN Human)
UseLentiviralTagsEGFPMutation3YF (Y412, Y470, Y486)PromoterU6, 5'LTRAvailable SinceSept. 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLCHKO_SFRS7_exon_deletion_3
Plasmid#155071PurposeLentiviral plasmid for expressing U6 driven hybrid guide (hg)RNA for deletion of SFRS7 exon using SpCas9 and LbCas12a nucleases (CHyMErA system)DepositorInsert(hg)RNA for deletion of SFRS7 exon using SpCas9 and LbCas12a nucleases
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceAug. 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-lincRNA-RorR-sh2 (Linc-sh2)
Plasmid#45765DepositorAvailable SinceAug. 12, 2013AvailabilityAcademic Institutions and Nonprofits only -