We narrowed to 10,749 results for: AGA
-
Plasmid#131755PurposepMAGIC L3-L2 entry plasmid, contains 3xHA tag+polyA; hU6-driven SaCas9 TRE#1 gRNA for 3-/4-component MultiSite Gateway Pro assembly. Allows C-term HA epitope fusion to dCas9 w/ TRE#1 gRNA expressionDepositorInsertTRE#1 SaCas9 gRNA
UseSynthetic Biology; Pmagic gateway entry plasmidTagsExpressionMutationPromoterhU6Available sinceOct. 15, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-DIO-HA-CB2SH3(-)-IRES-mCitrine
Plasmid#160069PurposeConditionally overexpress collybistin (CB2SH3-) and mCitrineDepositorInsertARHGEF9 (Arhgef9 Rat)
UseAAVTagsHA- in CB2SH3ExpressionMutationPromoterhuman Synapsin promoterAvailable sinceOct. 5, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLCHKO_SFRS7_exon_deletion_2
Plasmid#155070PurposeLentiviral plasmid for expressing U6 driven hybrid guide (hg)RNA for deletion of SFRS7 exon using SpCas9 and LbCas12a nucleases (CHyMErA system)DepositorInsert(hg)RNA for deletion of SFRS7 exon using SpCas9 and LbCas12a nucleases
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterU6Available sinceAug. 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLCHKO_MDM4_exon_deletion_2
Plasmid#155074PurposeLentiviral plasmid for expressing U6 driven hybrid guide (hg)RNA for deletion of MDM4 exon using SpCas9 and LbCas12a nucleases (CHyMErA system)DepositorInsert(hg)RNA for deletion of MDM4 exon using SpCas9 and LbCas12a nucleases
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterU6Available sinceAug. 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLCHKO_Ptbp_ex8_1
Plasmid#155081PurposeLentiviral plasmid for expressing U6 driven hybrid guide (hg)RNA for deletion of mouse Ptbp exon 8 using SpCas9 and LbCas12a nucleases (CHyMErA system)DepositorInsert(hg)RNA for deletion of mouse Ptbp exon 8 using SpCas9 and LbCas12a nucleases
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterU6Available sinceAug. 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLCHKO_Ptbp_ex8_4
Plasmid#155084PurposeLentiviral plasmid for expressing U6 driven hybrid guide (hg)RNA for deletion of mouse Ptbp exon 8 using SpCas9 and LbCas12a nucleases (CHyMErA system)DepositorInsert(hg)RNA for deletion of mouse Ptbp exon 8 using SpCas9 and LbCas12a nucleases
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterU6Available sinceAug. 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLCHKO_Ptbp_ex8_2
Plasmid#155082PurposeLentiviral plasmid for expressing U6 driven hybrid guide (hg)RNA for deletion of mouse Ptbp exon 8 using SpCas9 and LbCas12a nucleases (CHyMErA system)DepositorInsert(hg)RNA for deletion of mouse Ptbp exon 8 using SpCas9 and LbCas12a nucleases
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterU6Available sinceAug. 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
pSECC-sgSIK3-C
Plasmid#138674PurposeExpresses a mouse SIK3-targeting sgRNA, Cas9, and Cre-recombinaseDepositorInsertsgSIK3 mouse (Sik3 Mouse)
UseLentiviralTagsExpressionMutationPromoterhU6Available sinceMarch 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pSECC-sgSIK1-E
Plasmid#138669PurposeExpresses a mouse SIK1-targeting sgRNA, Cas9, and Cre-recombinaseDepositorInsertsgSIK1 mouse (Sik1 Mouse)
UseLentiviralTagsExpressionMutationPromoterhU6Available sinceMarch 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
FLAG-SENP2 CCm
Plasmid#126594PurposeExpresses siRNA resistant SENP2 (coiled-coil deletion) in mammalian cells, Dox inducible in TetR cell linesDepositorInsertSENP2 (SENP2 Human)
UseTagsFLAGExpressionMammalianMutationDeletion of amino acids 203-228 and siRNA resista…PromoterCMVAvailable sinceOct. 7, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAPM-D4 miR30-AGO1 ts2
Plasmid#115851PurposeAGO1 knockdownDepositorInsertAGO1 shRNA (AGO1 Human)
UseLentiviralTagsExpressionMutationPromoterSFFVAvailable sinceSept. 5, 2019AvailabilityAcademic Institutions and Nonprofits only -
pTBL405 CHYRON1 integration construct
Plasmid#126442PurposeTo integrate the CHYRON1 locus at HEK293site3.DepositorInsertspU6-CHYRON1 hgRNA
pCMV-puro
UseTagsExpressionMammalianMutationThe SpCas9 sgRNA constant region is mutated to ma…PromoterCMV and human U6Available sinceJune 5, 2019AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-N1 Dynamin1 T78R L84R T92R V118R
Plasmid#112106PurposeMammalian expression plasmid of GFP-tagged Dynamin protein.DepositorInsertDynamin1 (DNM1 Human)
UseTagsEGFPExpressionMammalianMutationT78R L84R T92R V118RPromoterCMVAvailable sinceAug. 14, 2018AvailabilityAcademic Institutions and Nonprofits only -
MSCV-PIG-N3FLAG-TAF12
Plasmid#105593Purposeretrovirally express mouse TAF12 with 3*FLAG tag at N terminal, GFP marker and puro resistanceDepositorInsertfull length TAF12 with silent mutations, making it resistant to TAF12 shRNA#364 (Taf12 Mouse)
UseRetroviralTags3*FLAGExpressionMammalianMutationsilent mutations to make it resistant to the targ…PromoterMSCV-LTRAvailable sinceMay 1, 2018AvailabilityAcademic Institutions and Nonprofits only -
MSCV-PIG-N3FLAG-TAF12(50-130)
Plasmid#105595Purposeretrovirally express mouse TAF12 HFD with 3*FLAG tag at N terminal, GFP marker and puro resistanceDepositorInsertTAF12 (AA 50-130)- histone fold domain-HFD (Taf12 Mouse)
UseRetroviralTags3*FLAGExpressionMammalianMutationtruncation fragments containing aa (50-130), and …PromoterMSCV-LTRAvailable sinceFeb. 15, 2018AvailabilityAcademic Institutions and Nonprofits only -
STARR-seq luciferase validation vector_ORI_GTSE1
Plasmid#99303PurposeLuciferase validation vector with GTSE1 enhancer inserted downstream of the reporter gene. The candidate's enhancer activity is reflected by luciferase activityDepositorInsertenhancer; chr22: 46718429 -46719913
UseLuciferase; Starr-seq luciferase validation vectorTagsExpressionMammalianMutationPromoterAvailable sinceOct. 23, 2017AvailabilityAcademic Institutions and Nonprofits only -
STARR-seq luciferase validation vector_mP_GTSE1
Plasmid#99304PurposeLuciferase validation vector with GTSE1 enhancer inserted downstream of the reporter gene. The candidate's enhancer activity is reflected by luciferase activityDepositorInsertenhancer; chr22: 46718429 -46719913
UseLuciferase; Starr-seq luciferase validation vectorTagsExpressionMammalianMutationPromoterAvailable sinceOct. 23, 2017AvailabilityAcademic Institutions and Nonprofits only -
STARR-seq luciferase validation vector_SCP1_GTSE1
Plasmid#99305PurposeLuciferase validation vector with GTSE1 enhancer inserted downstream of the reporter gene. The candidate's enhancer activity is reflected by luciferase activityDepositorInsertenhancer; chr22: 46718429 -46719913
UseLuciferase; Starr-seq luciferase validation vectorTagsExpressionMammalianMutationPromoterAvailable sinceOct. 23, 2017AvailabilityAcademic Institutions and Nonprofits only -
-
pLKO.1-shGBP1.2.mKO2
Plasmid#85210PurposeTRCN0000116120 (Target TGAGACGACGAAAGGCATGTA) for silencing GBP1 gene and express monomeric Kusabira-Orange2.DepositorInsertGBP1 (guanylate binding protein 1) (GBP1 Human)
UseLentiviral and RNAiTagsExpressionMammalianMutationPromoterRNA polymerase III promoter for human U6 snRNA fo…Available sinceOct. 4, 2017AvailabilityAcademic Institutions and Nonprofits only