We narrowed to 12,263 results for: shRNA
-
Plasmid#250237PurposeCre-dependent AAV expressing mCherry and a scrambled shRNA under EF1α promoter. Used as a non-targeting control for shRNA knockdownDepositorInsertshRNA-Scramble (SMARCA4 Synthetic)
UseAAV, Cre/Lox, Mouse Targeting, RNAi, and Syntheti…ExpressionMammalianPromoterEF1αAvailable SinceJan. 16, 2026AvailabilityAcademic Institutions and Nonprofits only -
PLL5.0-Anillin ShRNA-Cherry-Anillin deltaAnillin homology domain
Plasmid#187277PurposeLentiviral expression of shRNA targeting Anillin + reconstitution of Anillin delta Anillin homology domainDepositorInsertAnillin ,hsAnillin, Entrez Gene ANLN (a.k.a. FSGS8, Scraps, scra) (ANLN Human)
UseLentiviralTagsmCherryMutationdeltaAnillin homology domainPromoterU6, CMVAvailable SinceMay 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
pT7-EGFP-C1-HsNot1iso1_1-1605-del1079-1110-RNFtoAAA-shRNAres_W
Plasmid#147886PurposeMammalian Expression of HsNot1iso1_1-1605-del1097-1110-RNFtoAAA-shRNAresDepositorInsertHsNot1iso1_1-1605-del1097-1110-RNFtoAAA-shRNAres (CNOT1 Human)
ExpressionMammalianMutation1 silent mutation compared to the sequence of iso…Available SinceNov. 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
pT7-EGFP-C1-HsNot1iso1_1-1605-del1097-1110-RNFIKGRQtoAAADSYAA-shRNAres_W
Plasmid#147887PurposeMammalian Expression of HsNot1iso1_1-1605-del1097-1110-RNFIKGRQtoAAADSYAA-shRNAresDepositorInsertHsNot1iso1_1-1605-del1097-1110-RNFIKGRQtoAAADSYAA-shRNAres (CNOT1 Human)
ExpressionMammalianMutation1 silent mutation compared to the sequence of iso…Available SinceNov. 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
pOTTC1535 pscAAV mU6 shRNA(scram) CMV-IE Nuc-EYFP
Plasmid#135563PurposeAn AAV vector expressing scrambled shRNA and a nuclear EYFP reporterDepositorInsertsshRNA (scrambled)
Nuc-EYFP
UseAAV and RNAiTags3xNLSExpressionMammalianPromoterCMV-IE and mU6Available SinceSept. 1, 2021AvailabilityAcademic Institutions and Nonprofits only -
pSIREN-RetroQ-BPTF-sh28
Plasmid#73669PurposepSIREN-RetroQ vector containing shRNA sequence to BPTFDepositorAvailable SinceMarch 22, 2016AvailabilityIndustry, Academic Institutions, and Nonprofits -
pSIREN-RetroQ-BPTF-sh27
Plasmid#73668PurposepSIREN-RetroQ vector containing shRNA sequence to BPTFDepositorAvailable SinceApril 13, 2016AvailabilityIndustry, Academic Institutions, and Nonprofits -
pSicoR p53
Plasmid#12090PurposeCre-regulated lentiviral shRNA vector. Cre addition causes both EGFP and shRNA to be recombined out of the construct, turning OFF p53 shRNA expression.DepositorInsertp53 shRNA (Trp53 Mouse)
UseCre/Lox, Lentiviral, and RNAiExpressionMammalianMutationEGFP is expressed from this plasmid as a marker, …Available SinceAug. 4, 2006AvailabilityAcademic Institutions and Nonprofits only -
pSLIK sh human Rb 1534 hyg
Plasmid#31500DepositorInsertRB shRNA (RB1 Human)
UseLentiviral and RNAiTagsEGFPExpressionMammalianMutationThe target sequence for shRB 1534 is GAACGATTATCC…Available SinceAug. 18, 2011AvailabilityAcademic Institutions and Nonprofits only -
pSicoR Dnmt1
Plasmid#12166PurposeCre-regulated lentiviral shRNA vector. Cre addition causes both EGFP and shRNA to be recombined out of the construct, turning OFF Dnmt1 shRNA expression.DepositorInsertDnmt1 shRNA (Dnmt1 Mouse)
UseCre/Lox, Lentiviral, and RNAiExpressionMammalianMutationEGFP is expressed from this plasmid as a marker, …Available SinceJune 30, 2006AvailabilityAcademic Institutions and Nonprofits only -
Banshee shRandom mCherry
Plasmid#80145Purposeretroviral expression of random shRNADepositorInsertrandom shRNA
UseRetroviralExpressionMammalianAvailable SinceJuly 26, 2016AvailabilityAcademic Institutions and Nonprofits only -
FH95pUp95GW (B4)
Plasmid#74013Purposelentiviral expression of shRNA resistant Psd95-alpha-EGFP fusion and Psd95 shRNADepositorInsertPsd95 shRNA
UseLentiviral and RNAiExpressionMammalianPromoterH1Available SinceMarch 31, 2016AvailabilityAcademic Institutions and Nonprofits only -
pLKO-puro-hPPM1A
Plasmid#185382PurposeFor mammalian expression of shRNA: AGGGTAATGGGTTGCGATATG that targets human PPM1ADepositorAvailable SinceJune 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLKO-puro-hPPM1B
Plasmid#185383PurposeFor mammalian expression of shRNA: GAGCAGAAGAGGATGAATTTA that targets human PPM1BDepositorAvailable SinceJune 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSuper.mBeta826
Plasmid#12549DepositorInsertshRNA to mouse polymerase beta
UseRNAi and RetroviralExpressionMammalianAvailable SinceOct. 16, 2006AvailabilityAcademic Institutions and Nonprofits only -
p-AAV-sh[control]
Plasmid#75438Purposecontrol shRNA vectorDepositorInsertGFP
UseAAV and RNAiExpressionMammalianPromoterU6Available SinceAug. 9, 2016AvailabilityAcademic Institutions and Nonprofits only -
shCDK4/6(1)
Plasmid#73554Purposevector encoding both shRNA against CDK4(1) and shRNA against CDK6(1)DepositorInsertshRNA against CDK4 + shRNA against CDK6
UseRetroviralExpressionMammalianPromoterLTRAvailable SinceAug. 8, 2016AvailabilityAcademic Institutions and Nonprofits only -
shCDK4/6(2)
Plasmid#73555Purposevector encoding both shRNA against CDK4(2) and shRNA against CDK6(2)DepositorInsertshRNA against CDK4 + shRNA against CDK6
UseRetroviralExpressionMammalianPromoterLTRAvailable SinceAug. 8, 2016AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Ptet-RFP-shR-rtTA
Plasmid#35625PurposeTet-inducible AAV shRNA vector to test efficacy of shRNAs. Used in combination with pGFPns-reporter (Addgene plasmid #35626).DepositorTypeEmpty backboneUseAAV and RNAi; Tet inducibleExpressionMammalianPromoterPtetAvailable SinceApril 19, 2012AvailabilityAcademic Institutions and Nonprofits only -
UbC-TRE-mSOD2-tTS-IRES-EGFP
Plasmid#12390DepositorAvailable SinceSept. 1, 2006AvailabilityAcademic Institutions and Nonprofits only