We narrowed to 12,378 results for: shRNA
-
Plasmid#187275PurposeLentiviral expression of shRNA targeting Anillin + reconstitution of Anillin delta Myosin binding domainDepositorInsertAnillin ,hsAnillin, Entrez Gene ANLN (a.k.a. FSGS8, Scraps, scra) (ANLN Human)
UseLentiviralTagsmCherryMutationdeltaMyosin binding domainPromoterU6, CMVAvailable SinceSept. 23, 2022AvailabilityAcademic Institutions and Nonprofits only -
PLL5.0-Anillin ShRNA-Cherry-Anillin deltaAnillin homology domain
Plasmid#187277PurposeLentiviral expression of shRNA targeting Anillin + reconstitution of Anillin delta Anillin homology domainDepositorInsertAnillin ,hsAnillin, Entrez Gene ANLN (a.k.a. FSGS8, Scraps, scra) (ANLN Human)
UseLentiviralTagsmCherryMutationdeltaAnillin homology domainPromoterU6, CMVAvailable SinceMay 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLL5.0 E-cadherin shRNA/E-cadherin GFP-IRES-HA-H-Ras V12
Plasmid#101285PurposeLentiviral expression ,was generatedby recombining bothIRES an HA-tagged H-Ras V12 into SbfI site of pLL5.0 Ecadherin shRNA/mEcad-GFPDepositorInsertE-Cadherin-GFP-H-Ras
UseLentiviralTagsGFPExpressionMammalianMutationH-Ras V12Available SinceOct. 25, 2017AvailabilityAcademic Institutions and Nonprofits only -
MSCV-miRE-shRNA IFT88-PGK-neo-IRES-GFP
Plasmid#73576PurposeMammalian retroviral expression vectorDepositorAvailable SinceFeb. 22, 2016AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Camk2a(short)-mRFP1.Letm1[miR30-shRNA]-WPRE
Plasmid#214404PurposeExpresses a mouse Letm1 specific microRNA in tandem with mRFP1DepositorInsertmRFP1 with Letm1 specific miRNA
UseAAVExpressionMammalianAvailable SinceFeb. 19, 2026AvailabilityAcademic Institutions and Nonprofits only -
AAV-EF1α-DIO-DSE-mCherry-PSE-shRNA-Numb
Plasmid#250238PurposeCre-dependent AAV expressing mCherry and an shRNA targeting Numb under EF1α promoter for selective Numb knockdownDepositorInsertNumb (Numb Mouse)
UseAAV, Cre/Lox, Mouse Targeting, and RNAiExpressionMammalianPromoterEF1αAvailable SinceJan. 16, 2026AvailabilityAcademic Institutions and Nonprofits only -
AAV-EF1α-DIO-DSE-mCherry-PSE-shRNA-Scramble
Plasmid#250237PurposeCre-dependent AAV expressing mCherry and a scrambled shRNA under EF1α promoter. Used as a non-targeting control for shRNA knockdownDepositorInsertshRNA-Scramble (SMARCA4 Synthetic)
UseAAV, Cre/Lox, Mouse Targeting, RNAi, and Syntheti…ExpressionMammalianPromoterEF1αAvailable SinceJan. 16, 2026AvailabilityAcademic Institutions and Nonprofits only -
pT7-EGFP-C1-HsNot1iso1_1-1605-del1079-1110-RNFtoAAA-shRNAres_W
Plasmid#147886PurposeMammalian Expression of HsNot1iso1_1-1605-del1097-1110-RNFtoAAA-shRNAresDepositorInsertHsNot1iso1_1-1605-del1097-1110-RNFtoAAA-shRNAres (CNOT1 Human)
ExpressionMammalianMutation1 silent mutation compared to the sequence of iso…Available SinceNov. 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
pT7-EGFP-C1-HsNot1iso1_1-1605-del1097-1110-RNFIKGRQtoAAADSYAA-shRNAres_W
Plasmid#147887PurposeMammalian Expression of HsNot1iso1_1-1605-del1097-1110-RNFIKGRQtoAAADSYAA-shRNAresDepositorInsertHsNot1iso1_1-1605-del1097-1110-RNFIKGRQtoAAADSYAA-shRNAres (CNOT1 Human)
ExpressionMammalianMutation1 silent mutation compared to the sequence of iso…Available SinceNov. 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
pOTTC1535 pscAAV mU6 shRNA(scram) CMV-IE Nuc-EYFP
Plasmid#135563PurposeAn AAV vector expressing scrambled shRNA and a nuclear EYFP reporterDepositorInsertsshRNA (scrambled)
Nuc-EYFP
UseAAV and RNAiTags3xNLSExpressionMammalianPromoterCMV-IE and mU6Available SinceSept. 1, 2021AvailabilityAcademic Institutions and Nonprofits only -
pSicoR p53
Plasmid#12090PurposeCre-regulated lentiviral shRNA vector. Cre addition causes both EGFP and shRNA to be recombined out of the construct, turning OFF p53 shRNA expression.DepositorInsertp53 shRNA (Trp53 Mouse)
UseCre/Lox, Lentiviral, and RNAiExpressionMammalianMutationEGFP is expressed from this plasmid as a marker, …Available SinceAug. 4, 2006AvailabilityAcademic Institutions and Nonprofits only -
pSIREN-RetroQ-BPTF-sh28
Plasmid#73669PurposepSIREN-RetroQ vector containing shRNA sequence to BPTFDepositorAvailable SinceMarch 22, 2016AvailabilityIndustry, Academic Institutions, and Nonprofits -
pSIREN-RetroQ-BPTF-sh27
Plasmid#73668PurposepSIREN-RetroQ vector containing shRNA sequence to BPTFDepositorAvailable SinceApril 13, 2016AvailabilityIndustry, Academic Institutions, and Nonprofits -
pSLIK sh human Rb 1534 hyg
Plasmid#31500DepositorInsertRB shRNA (RB1 Human)
UseLentiviral and RNAiTagsEGFPExpressionMammalianMutationThe target sequence for shRB 1534 is GAACGATTATCC…Available SinceAug. 18, 2011AvailabilityAcademic Institutions and Nonprofits only -
pSicoR Dnmt1
Plasmid#12166PurposeCre-regulated lentiviral shRNA vector. Cre addition causes both EGFP and shRNA to be recombined out of the construct, turning OFF Dnmt1 shRNA expression.DepositorInsertDnmt1 shRNA (Dnmt1 Mouse)
UseCre/Lox, Lentiviral, and RNAiExpressionMammalianMutationEGFP is expressed from this plasmid as a marker, …Available SinceJune 30, 2006AvailabilityAcademic Institutions and Nonprofits only -
Banshee shRandom mCherry
Plasmid#80145Purposeretroviral expression of random shRNADepositorInsertrandom shRNA
UseRetroviralExpressionMammalianAvailable SinceJuly 26, 2016AvailabilityAcademic Institutions and Nonprofits only -
FH95pUp95GW (B4)
Plasmid#74013Purposelentiviral expression of shRNA resistant Psd95-alpha-EGFP fusion and Psd95 shRNADepositorInsertPsd95 shRNA
UseLentiviral and RNAiExpressionMammalianPromoterH1Available SinceMarch 31, 2016AvailabilityAcademic Institutions and Nonprofits only -
pLKO-puro-hPPM1A
Plasmid#185382PurposeFor mammalian expression of shRNA: AGGGTAATGGGTTGCGATATG that targets human PPM1ADepositorAvailable SinceJune 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLKO-puro-hPPM1B
Plasmid#185383PurposeFor mammalian expression of shRNA: GAGCAGAAGAGGATGAATTTA that targets human PPM1BDepositorAvailable SinceJune 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSuper.mBeta826
Plasmid#12549DepositorInsertshRNA to mouse polymerase beta
UseRNAi and RetroviralExpressionMammalianAvailable SinceOct. 16, 2006AvailabilityAcademic Institutions and Nonprofits only