We narrowed to 26,431 results for: GFP
-
Plasmid#15834DepositorInserthtt 103Q Delta Pro (HTT Human)
TagsFLAG and GFPExpressionYeastMutationProline-rich region removedAvailable SinceOct. 5, 2007AvailabilityAcademic Institutions and Nonprofits only -
eGFP L202 gRNA
Plasmid#119132PurposegRNA that guides Cas9 and APOBEC complexes to L202 in eGFP.DepositorInserteGFP L202 gRNA
UseCRISPRMutationNonePromoterU6Available SinceJune 10, 2019AvailabilityAcademic Institutions and Nonprofits only -
EGFP-Lyn11C32S-PIP4K2A
Plasmid#202748Purposeweakly plasma membrane targeted fluorescent protein-tagged enzymeDepositorInsertEGFP:LYN (1-11) (C3S):PIP4K2A (PIP4K2A Human)
ExpressionMammalianAvailable SinceJuly 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
Chx10BP-LCL-EGFP
Plasmid#73992PurposeCre-dependent reporter plasmid for bipolar cells in the retinaDepositorInsertChx10BP-loxP-mCherry-loxP-EGFP
UseCre/LoxExpressionMammalianPromoterChx10BP (chx10 enhancer)Available SinceMay 4, 2016AvailabilityAcademic Institutions and Nonprofits only -
pFasBac+GFP-CAMSAP3
Plasmid#59038Purposefor baculovirus expression of mouse CAMSAP3 in Sf9 cellsDepositorAvailable SinceAug. 27, 2014AvailabilityAcademic Institutions and Nonprofits only -
pT7-EGFP-C1-HsNot6L
Plasmid#37369DepositorAvailable SinceJuly 13, 2012AvailabilityAcademic Institutions and Nonprofits only -
pCDNA5 TEX264wt-cGFP
Plasmid#220211PurposeMammalian expression of wild type TEX264 fused at C-terminus to GFPDepositorAvailable SinceJune 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
GAL FLAG25QDProGFP p306
Plasmid#15831DepositorInserthtt 25Q Delta Pro (HTT Human)
TagsFLAG and GFPExpressionYeastMutationProline-rich region removedAvailable SinceOct. 5, 2007AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-Alu-Lin28
Plasmid#92346PurposePlasmid for expression of GFP gene with a Lin28 gene derived Alu element containing 3'UTR.DepositorInsertLin28 gene derived Alu element containing 3'UTR (LIN28A Human)
ExpressionMammalianPromoterCMVAvailable SinceJune 21, 2017AvailabilityAcademic Institutions and Nonprofits only -
PKAcs-GGSD5X-GFP
Plasmid#108584PurposeExpresses PKAcs-GFP fusion in mammalian cells with flexible linkerDepositorInsertprotein kinase A, catalytic subunit
TagsGFPExpressionMammalianMutationH87Q and W196RAvailable SinceFeb. 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
GFP-itis pBE-nt
Plasmid#195343PurposeBase editor plasmid expressing ABE8e-NG-Cas9n under Theophylline Riboswitch and constituitively expressed nonsense non-targeting gRNADepositorInsertsecTadA(8e)-SpCas9-NG
gRNA gtgcacgacgccgtatgcga
UseCRISPRMutationSpCas9n-NG: D10A, L1111R, D1135V, G1218R, E1219F,…PromoterLac and ProCAvailable SinceJan. 31, 2023AvailabilityAcademic Institutions and Nonprofits only -
mPA-GFP-Farnesyl-5
Plasmid#57133PurposeLocalization: Membrane, Excitation: 400 / 504, Emission: 515 / 517DepositorInsertFarnesyl (HRAS Human)
TagsmPA-GFPExpressionMammalianMutationencodes final 20 aa of NM_001130442.1PromoterCMVAvailable SinceJan. 29, 2015AvailabilityIndustry, Academic Institutions, and Nonprofits -
pETSXM2-pLacI-GFP
Plasmid#174617PurposeBacterial expression of GFP.DepositorInsertGFP
UseSynthetic BiologyExpressionBacterialPromoterpLacIAvailable SinceOct. 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
pRK5-mEGFP-CALR-WT
Plasmid#194578PurposeMammalian Expression of mEGFP-CALR WT Fusion ProteinDepositorAvailable SinceFeb. 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
eGFP-proα2(I)-G610C
Plasmid#119827PurposeExpresses mouse Type I procollagen α2 chain (Col1a2) with Gly610Cys mutation and GFP between signal sequence and exon 6DepositorInsertType I procollagen α2 chain (Col1a2 Mouse)
TagseGFPExpressionMammalianMutationCol1a2 exons 2-5 replaced by fluorescent tag, Gly…PromoterCMVAvailable SinceJan. 28, 2019AvailabilityAcademic Institutions and Nonprofits only -
pPROBE-gfp[AAV]
Plasmid#40168DepositorInsertPromotor probe
Available SinceDec. 6, 2012AvailabilityAcademic Institutions and Nonprofits only -
CB6-GFP-TAOK2
Plasmid#197110PurposeExpression of GFP-tagged TAOK2 / PSK1 in mammalian cellsDepositorAvailable SinceMarch 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
625 pTol2-tp1bglob:egfp
Plasmid#73586PurposeTol2 vector with Notch responsive tp1 element driving expression of EGFPDepositorInserttp1 element driving EGFP
Available SinceFeb. 22, 2016AvailabilityAcademic Institutions and Nonprofits only -
PGK EGFP-RAB3A-WT
Plasmid#206146PurposePGK EGFP-RAB3A-WTDepositorAvailable SinceJuly 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
HT109_pAAV_hSyn-DiO-SomQuasAr6a_EGFP
Plasmid#190878PurposeCre-on expression of soma-targeted QuasAr6a under an neuronal promoterDepositorInsertsomQuasAr6a_EGFP
UseAAVTagsEGFPPromoterhSynAvailable SinceNov. 17, 2022AvailabilityAcademic Institutions and Nonprofits only