We narrowed to 9,829 results for: CAG
-
Plasmid#107726PurposeKnock out of EB1 in human cells by CRISPR/Cas9DepositorAvailable sinceApril 30, 2018AvailabilityAcademic Institutions and Nonprofits onlyCited by
-
pCRRNA-G20-R20
Plasmid#101822PurposeRepress mCherry and GFP independently, with different strengthsDepositorInsertcrRNAs targeting GFP and mCherry
UseCRISPR and Synthetic BiologyPromoterSpy 1049Available sinceOct. 24, 2017AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pDECKO_UCA1
Plasmid#72628PurposeExpresses two gRNAs targeting the UCA1 promoterDepositorInsertgRNAs toward UCA1
ExpressionMammalianPromoterU6 (gRNA1) and H1 (gRNA2)Available sinceJune 14, 2016AvailabilityAcademic Institutions and Nonprofits only -
pLKO1-puro-U6-sgRNA-TGM2
Plasmid#69239PurposeU6 driven SpCas9 sgRNA expression for TGM2 siteDepositorAvailable sinceOct. 20, 2015AvailabilityAcademic Institutions and Nonprofits only -
pColE1_sgRNA_pos5_AmpR
Plasmid#119148PurposeEncodes sgRNA targeting position 5 in pColE1_70a_deGFP_KanRDepositorInsertsgRNA targeting position 5 in pColE1_70a_deGFP_KanR
UseCrisprAvailable sinceNov. 28, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLG1 library vector (pU6-sgRNA Ef1alpha-Puro-T2A-BFP)
Plasmid#217305PurposesgRNA BFP + PuromycinDepositorInsertpU6-sgRNA, Ef1alpha-Puro-T2A-BFP
UseCRISPR and Synthetic BiologyPromoterU6, Ef1alphaAvailable sinceApril 18, 2024AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pGMC00028 (aka pTS0057)
Plasmid#200832PurposeAAVS1 guide RNA cloned into the lentiSAM puro backboneDepositorInsertAAVS1 guide RNA
UseLentiviralExpressionMammalianAvailable sinceApril 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
pR023_PIE-PUM2
Plasmid#204819PurposeExpression PIE-PUM2 fusion protein in mammalian cellsDepositorInsertPumilio 2 (PUM2 Human)
TagsHA-Flag-rApobec1 and huADAR2ddExpressionMammalianPromoterchicken β-actin promoterAvailable sinceNov. 10, 2023AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPRv2-KLF7-1
Plasmid#169797PurposeExpresses Cas9 and guide RNA for the site neighbouring KLF7 gene.DepositorInsertguide RNA for KLF7 neighbouring region
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available sinceJune 11, 2021AvailabilityAcademic Institutions and Nonprofits only -
tet-pLKO.puro_shHuR CDS
Plasmid#110411PurposeTRCN0000276129 (Target CGAGCTCAGAGGTGATCAAAG), silence human ELAVL1 (HuR) gene, doxycycline inducible, puromycin selectionDepositorInsertELAVL1 (HuR)
UseLentiviral and RNAiExpressionMammalianPromoterH1/TO (RNA PolIII)Available sinceFeb. 23, 2021AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pJG493
Plasmid#91197PurposeWDV replicon T-DNA for gene targeting in wheat scutella, no Cas9 control (gUbi1+gUbi8+donor)DepositorInsertgUbi1+gUbi8+donor
UseCRISPRExpressionPlantAvailable sinceSept. 29, 2017AvailabilityAcademic Institutions and Nonprofits only -
pDual_dsCas9_Blast_hs_TP73
Plasmid#214691PurposeLentiviral expression vector for an inducible Cas9-P2A-Blasticidin resistance casette with two sgRNA sequences against human TP73DepositorInsertdgRNA_TP73 (TP73 Human)
UseCRISPR and LentiviralAvailable sinceDec. 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
PX459-CDKN1A
Plasmid#217457PurposeFor CDKN1A (p21) knockoutDepositorAvailable sinceApril 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pHeEf1a-mEGFP-NLS
Plasmid#205012PurposeThe vector contains 1kbp of the upstream and downstream regions of the ef1a gene from Hypsibius exemplaris, with the mEGFP gene with NLS sequence positioned in between.DepositorInsertmEGFP-NLS flanked by 1kbp upstream and downstream of the ef1a gene from Hypsibius exemplaris
UseTardigrade expressionAvailable sinceAug. 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
pRvSAHS1-SAHS1-mEGFP
Plasmid#205007PurposeThe vector contains 1kbp of the upstream and downstream regions of the sahs1 gene from Ramazzottius varieornatus, with the RvSAHS1-mEGFP gene positioned in between.DepositorInsertRvSAHS1-mEGFP with 1kbp upstream and downstream of the sahs1 gene from Ramazzottius varieornatus
UseTardigrade expressionAvailable sinceAug. 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgSmarca4#1/Cre
Plasmid#173619PurposeExpresses a Smarca4-targeting gRNA and Cre-recombinaseDepositorInsertgRNA targeting Smarca4 (Smarca4 Mouse)
UseCRISPR, Cre/Lox, and LentiviralAvailable sinceJune 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-FLEX-SaCas9-U6-sgVamp2
Plasmid#159920PurposeMutagenesis of Vamp2DepositorInsertVamp2 (Vamp2 Mouse)
UseAAV, CRISPR, and Mouse TargetingAvailable sinceNov. 16, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-shCELF4-4404
Plasmid#115465PurposeConstitutive lentiviral expressionDepositorAvailable sinceSept. 17, 2018AvailabilityAcademic Institutions and Nonprofits only -
pSLQ7529 pHR (hU6-crLPT-EFS-PuroR-WPRE)
Plasmid#214877PurposeLentiviral vector encoding RfxCas13d targeting LPT guide arrayDepositorInserthU6-crLPT-EFS-PuroR-WPRE
UseCRISPR and LentiviralExpressionMammalianPromoterhU6Available sinceApril 4, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDECKO_mCherry_AAVS1
Plasmid#141212PurposepDECKO_mCherry_AAVS1_186. Targeting, non-essential locus controlDepositorInsertgRNA
UseLentiviralExpressionMammalianAvailable sinceJuly 2, 2020AvailabilityAcademic Institutions and Nonprofits only