We narrowed to 9,707 results for: crispr plasmids
-
Plasmid#42242PurposegRNA targeted to zebrafish gene drd3DepositorAvailable SinceJan. 31, 2013AvailabilityAcademic Institutions and Nonprofits only
-
pADH100Cau
Plasmid#244817PurposeModified plasmid from pADH100 to perform HIS-FLP CRISPR in Candidozyma aurisDepositorInsertSNR52p from C. auris
UseCRISPRTagsHIS1 terminator from C. auris and NAT resistance …ExpressionYeastPromoterSNR52pAvailable SinceDec. 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pADH99Cau
Plasmid#244807PurposeModified plasmid from pADH99 to perform HIS-FLP CRISPR in Candidozyma aurisDepositorInsertCauHIS1_US
UseCRISPRTagsC. albicans MAL2 promoter, C. albicans codon opti…ExpressionYeastAvailable SinceNov. 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pUt-mNF-Cas13d
Plasmid#224789PurposeLPUtopia matching RMCE donor plasmid with mCherry-P2A-RfxCas13d Negative-Feedback circuit. Use BlastR for positive selection and HSV-TK for negative selection.DepositorInsertmCherry-P2A-RfxCas13d
UseCRISPR and Synthetic BiologyExpressionMammalianPromoterCMV-d2iAvailable SinceOct. 31, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-dSa VP64 Hbb
Plasmid#99693PurposeExpresses dSa Cas9 fused to gold standard VP64 activator domain and Sa sgRNA for Hbb promoter, vector allows for activation of mouse Hbb, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Hbb (gRNA: GGGGTAAGGGGAGCAAGGTC) (Hbb Mouse, Synthetic)
UseAAV and CRISPRTagsVP64Mutationdead Cas9Available SinceMay 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pGEL670
Plasmid#196818PurposeLrCas9 cytosine base editing plasmid in riceDepositorTypeEmpty backboneUseCRISPR and Synthetic BiologyExpressionPlantPromoterZmUbiAvailable SinceOct. 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
pGEL671
Plasmid#196819PurposeLrCas9 cytosine base editing plasmid in wheatDepositorTypeEmpty backboneUseCRISPR and Synthetic BiologyExpressionPlantPromoterZmUbiAvailable SinceOct. 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
pGEL672
Plasmid#196820PurposeLrCas9 adenine base editing plasmid V1.0 in riceDepositorTypeEmpty backboneUseCRISPR and Synthetic BiologyExpressionPlantPromoterZmUbiAvailable SinceOct. 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
pGEL673
Plasmid#196821PurposeLrCas9 adenine base editing plasmid V2.0 in riceDepositorTypeEmpty backboneUseCRISPR and Synthetic BiologyExpressionPlantPromoterZmUbiAvailable SinceOct. 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCas9FnCpf1GG
Plasmid#131013PurposeBackbone plasmid for generating CRISPR arrays for composite array utilized by SpCas9 and FnCas12a using CRATES. Contains a GFP-dropout cassette and two direct repeats.DepositorInsertsdirect repeat of SpCas9
GFP expression cassette
direct repeat of FnCas12a
UseCRISPRExpressionBacterialAvailable SinceSept. 18, 2019AvailabilityAcademic Institutions and Nonprofits only -
pPlatTET-gRNA2
Plasmid#82559PurposeAll in one vector which contains Cas9 peptide array (linker length: 22aa), antibody-sfGFP-TET1CD, and gRNA expression system.DepositorInsertdCas9-5xPlat2AflD-P2A-scFvGCN4sfGFPTET1CD
ExpressionMammalianAvailable SinceSept. 29, 2016AvailabilityAcademic Institutions and Nonprofits only -
TOP2A sgRNA1
Plasmid#138190Purpose3rd generation lentiviral gRNA plasmid targeting human TOP2ADepositorAvailable SinceMarch 18, 2020AvailabilityAcademic Institutions and Nonprofits only -
TOP2A sgRNA2
Plasmid#138191Purpose3rd generation lentiviral gRNA plasmid targeting human TOP2ADepositorAvailable SinceMarch 18, 2020AvailabilityAcademic Institutions and Nonprofits only -
AAVS1_Puro_H2BK_mNG_hSLBP(18-108)
Plasmid#191529PurposeDonor for targeted integration of mNG_hSLBP(18-108) probe to the AAVS1 safe harbor locusDepositorInsertH2BK_mNG_hSLBP(18-108)
UseCRISPR and Synthetic BiologyTagsmNeonGreen (mNG)ExpressionMammalianAvailable SinceFeb. 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCG-scr
Plasmid#229847PurposeExpresses wild-type Cas9 and scrambled gRNA.DepositorInsertguide RNA with scrambled sequence
UseCRISPRExpressionMammalianAvailable SinceJan. 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
AAV:ITR-U6-sgRNA(backbone)-hSyn-Cre-2A-EGFP-KASH-WPRE-shortPA-ITR
Plasmid#60231PurposeExpresses Cre recombinase and KASH-tagged EGFP from the hSyn promoter and one U6-driven sgRNA. AAV backbone with SapI spacer for sgRNA cloning.DepositorInsertssgRNA
Cre recombinase
EGFP
UseAAV, CRISPR, Cre/Lox, and Mouse TargetingTagsCre-HA-P2A and EGFP-KASHExpressionMammalianPromoterU6 and hSynAvailable SinceOct. 9, 2014AvailabilityAcademic Institutions and Nonprofits only -
AAV:ITR-U6-sgRNA(backbone)-pEFS-Rluc-2A-Cre-WPRE-hGHpA-ITR
Plasmid#60226PurposeExpresses Cre recombinase and Renilla luciferase from the EFS promoter and one U6-driven sgRNA. AAV backbone with SapI spacer for sgRNA cloning.DepositorInsertssgRNA
Renilla luciferase
Cre recombinase
UseAAV, CRISPR, Cre/Lox, Luciferase, and Mouse Targe…TagsCre-HA and Rluc-P2AExpressionMammalianPromoterEFS and U6Available SinceOct. 9, 2014AvailabilityAcademic Institutions and Nonprofits only -
pCMV-T7-TadCBEd-SpCas9-P2A-EGFP (BKS327)
Plasmid#223123PurposepCMV and pT7 Human expression plasmid for TadCBEd-SpCas9 with C-term BPNLS-P2A-EGFPDepositorInserthuman codon optimized TadCBEd-SpCas9-2xUGI-P2A-EGFP
UseCRISPRTags2xUGI-BPNLS-P2A-EGFP and BPNLS-TadA-CDdExpressionMammalianMutationTadA-CDd mutations; nSpCas9=D10APromoterCMV and T7Available SinceApril 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCMV-T7-TadCBEd-SpG-P2A-EGFP (BKS777/AHK571)
Plasmid#223124PurposepCMV and pT7 Human expression plasmid for TadCBEd-SpG with C-term BPNLS-P2A-EGFPDepositorInserthuman codon optimized TadCBEd-SpG-2xUGI-P2A-EGFP
UseCRISPRTags2xUGI-BPNLS-P2A-EGFP and BPNLS-TadA-CDdExpressionMammalianMutationTadA-CDd mutations; nSpG=D10A/D1135L/S1136W/G1218…PromoterCMV and T7Available SinceApril 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
pET-28b-T7-bLbCas12a-NLS(nucleoplasmin)-6xHis (RTW645)
Plasmid#114070PurposeT7 promoter bacterial expression plasmid for bacterial codon optimized LbCas12a with C-terminal NLS and His-tagDepositorInsertbacteria codon optimized LbCas12a with C-terminal NLS and His-tag
TagsNLS(nucleoplasmin) and 6xHisExpressionBacterialAvailable SinceDec. 11, 2018AvailabilityAcademic Institutions and Nonprofits only