We narrowed to 6,147 results for: cas9 expression plasmid
-
Plasmid#154374PurposeVector for Flp-dependent expression of EGFP tagged KASH protein domainDepositorInsertEGFP-KASH
UseAAVExpressionMammalianAvailable SinceAug. 11, 2020AvailabilityAcademic Institutions and Nonprofits only -
pMOD8A-RGR-r10
Plasmid#74370PurposeThis plasmid constitutively expresses gRNA-r10 from an AHD1 promoter using the RGR design. Integrates in the W303 HIS locus and restores HIS function.DepositorArticleInsertRGR-r10
UseCRISPR and Synthetic BiologyExpressionYeastPromoterADH1Available SinceApril 4, 2016AvailabilityAcademic Institutions and Nonprofits only -
pMOD8A-iRGR-r11
Plasmid#74369PurposeThis plasmid constitutively expresses gRNA-r11 from an AHD1 promoter using the insulated RGR design. Integrates in the W303 HIS locus and restores HIS function.DepositorArticleInsertRGR-r11
UseCRISPR and Synthetic BiologyExpressionYeastPromoterAHD1Available SinceApril 4, 2016AvailabilityAcademic Institutions and Nonprofits only -
pIVT-ABE-DEN2
Plasmid#238020Purposefor DNA-free adenine base editing in rice and wheat or other plantsDepositorInsertTadA8e-nSpCas9(D10A)
ExpressionPlantMutationD10A for SpCas9PromoterT7Available SinceOct. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pIVT-ABE-TMV
Plasmid#238021Purposefor DNA-free adenine base editing in rice and wheat or other plantsDepositorInsertTadA8e-nSpCas9(D10A)
ExpressionPlantMutationD10A for SpCas9PromoterT7Available SinceOct. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pIVT-A3A-DEN2
Plasmid#238019Purposefor DNA-free cytosine base editing in rice and wheat or other plantsDepositorInsertA3A-nSpCas9(D10A)-UGI
ExpressionPlantMutationD10A for SpCas9PromoterT7Available SinceOct. 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
LLP453 pEf1a-NLS-aGCN4-mCherry
Plasmid#100945PurposemCherry fusion to single change variable fragment antibody GCN4 for use in SunTag system , with 3xTy1 tagDepositorInsertscFvGCN4, sfGFP, GB1, mCherry
Tags3xTy1ExpressionMammalianAvailable SinceJune 21, 2018AvailabilityAcademic Institutions and Nonprofits only -
GFP-itis pBE-t
Plasmid#195342PurposeBase editor plasmid expressing ABE8e-NG-Cas9n under Theophylline Riboswitch and constituitively expressed gRNA targeting EGFP A110VDepositorInsertsecTadA(8e)-SpCas9-NG
gRNA ctctacgcgggtcttgtagt
UseCRISPRMutationSpCas9n-NG: D10A, L1111R, D1135V, G1218R, E1219F,…PromoterLac and ProCAvailable SinceJan. 31, 2023AvailabilityAcademic Institutions and Nonprofits only -
GFP-itis pBE-nt
Plasmid#195343PurposeBase editor plasmid expressing ABE8e-NG-Cas9n under Theophylline Riboswitch and constituitively expressed nonsense non-targeting gRNADepositorInsertsecTadA(8e)-SpCas9-NG
gRNA gtgcacgacgccgtatgcga
UseCRISPRMutationSpCas9n-NG: D10A, L1111R, D1135V, G1218R, E1219F,…PromoterLac and ProCAvailable SinceJan. 31, 2023AvailabilityAcademic Institutions and Nonprofits only -
pX330 p53
Plasmid#59910PurposepX330 backbone expressing sgRNA targeting p53 to edit mouse p53. Expresses Cas9 from CBh promoterDepositorAvailable SinceMarch 16, 2015AvailabilityAcademic Institutions and Nonprofits only -
pX330 Pten
Plasmid#59909PurposepX330 backbone expressing sgRNA targeting Pten to edit mouse Pten. Expresses Cas9 from CBh promoterDepositorAvailable SinceMarch 9, 2015AvailabilityAcademic Institutions and Nonprofits only -
pX330 Ctnnb1.1
Plasmid#59911PurposepX330 backbone expressing sgRNA targeting Ctnnb1 to edit mouse beta-Catenin. Expresses Cas9 from CBh promoterDepositorAvailable SinceMarch 9, 2015AvailabilityAcademic Institutions and Nonprofits only -
pET-28b-T7-henAsCas12a-HF1(E174R/N282A/S542R/K548R)-NLS(nucleoplasmin)-6xHis (AAS1935)
Plasmid#114073PurposeT7 promoter bacterial expression plasmid for human codon optimized enAsCas12a-HF1(E174R/N282A/S542R/K548R) with C-terminal NLS and His-tagDepositorInserthuman codon optimized enAsCas12a-HF1 (E174R/N282A/S542R/K548R) with C-terminal NLS and His-tag
TagsNLS(nucleoplasmin) and 6xHisExpressionBacterialMutationE174R, S542R, K548R and N282AAvailable SinceDec. 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
pET-28b-T7-hAsCas12a-enRVR(E174R/S542R/K548V/N552R)-NLS(nucleoplasmin)-6xHis (AAS1931)
Plasmid#114075PurposeT7 promoter bacterial expression plasmid for human codon optimized AsCas12a-enRVR(E174R/S542R/K548V/N552R) with C-terminal NLS and His-tagDepositorInserthuman codon optimized AsCas12a-enRVR (E174R/S542R/K548V/N552R) with C-terminal NLS and His-tag
TagsNLS(nucleoplasmin) and 6xHisExpressionBacterialMutationE174R, S542R, K548V and N552RAvailable SinceDec. 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
Lenti-EF1alpha-scFv-VP64_Blast
Plasmid#192655Purpose3rd generation lenti vector encoding scFv-VP64 with 2A Blast resistance markerDepositorInsertscFv-VP64
UseCRISPR and LentiviralExpressionMammalianPromoterEF1aAvailable SinceJan. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCR-U6-gRNA-TRE3G-TdTomato
Plasmid#192658PurposeA plasmid encoding TRE3G sgRNA and TRE3G-promoter-TdTomatoDepositorInsertTdTomato
ExpressionMammalianPromoterU6, TRE3GAvailable SinceJan. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
pGH224_sgRNA_2xMS2_Puro
Plasmid#85413PurposehU6 driven sgRNA vector with 2xMS2 vectors with puro selectable markerDepositorInsertpuromycin resistance
UseCRISPR and LentiviralExpressionMammalianAvailable SinceDec. 15, 2016AvailabilityAcademic Institutions and Nonprofits only -
pV1200
Plasmid#111429PurposeCaCas9/gRNA Solo entry plasmid for cloning guides - contains stuffer with BsmBI sites - integrates at ENO1 - Recyclable for serial mutagenesis (Sap2-FLP)DepositorInsertCaCas9/sgRNA-BsmBI stuffer
UseCRISPRExpressionYeastAvailable SinceOct. 17, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCR-U6-gRNA-miniCMV-TdTomato
Plasmid#192656PurposeA plasmid encoding miniCMV sgRNA and miniCMV-promoter-TdTomatoDepositorInsertTdTomato
ExpressionMammalianPromoterU6, miniCMVAvailable SinceDec. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pYPQ166-SpRY
Plasmid#161520PurposeGateway entry plasmid (attL1 & attR5) expressing 3_FLAG-NLS-zSpRYCas9-NLS without promoterDepositorInsertzSpRYCas9
UseCRISPR; Gateway compatible zsprycas9 entry cloneTags3X FLAG, NLS and NLSExpressionPlantAvailable SinceFeb. 26, 2021AvailabilityAcademic Institutions and Nonprofits only