-
Plasmid#201914PurposeCas9-EDV production plasmid. Expresses the v2 Gag-Cas9 polypeptide (CAG promoter) and sgRNA (human U6 promoter. BsmBI cutsites for spacer insertion)DepositorInsertGag-Cas9 v2
UseTagsExpressionMammalianMutationPromoterCAGAvailable sinceAug. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLenLox_U6 p53
Plasmid#59360PurposeLentiviral expression vector: p53 shRNA under control of mouse U6 promoter, EGFP-expression driven by CAG promoter to monitor expression.DepositorInsertsUseLentiviralTagsExpressionMammalianMutationPromoterCAG and mouse U6Available sinceJuly 21, 2015AvailabilityAcademic Institutions and Nonprofits only -
pCI H2B-RFP
Plasmid#92398PurposeUbiquitous expression plasmid, contains CAG promoter (CMV immediate early enhancer and chicken beta actin promoter), MCS and IRES controlled Histone2B-mRFP1 reporter.DepositorInsertIRES H2B RFP
UseTagsExpressionMammalianMutationPromoterCAGAvailable sinceAug. 24, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCI H2B-GFP
Plasmid#92399PurposeUbiquitous expression plasmid, contains CAG promoter (CMV immediate early enhancer and chicken beta actin promoter), MCS and IRES controlled Histone2B-EGFP reporter.DepositorInsertIRES H2B EGFP
UseTagsExpressionMammalianMutationPromoterCAGAvailable sinceAug. 24, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCAT007
Plasmid#171634PurposePlasmid containing a U6 promoter expressing a spyCas9 sgRNA targeting TRAC and CAG promoter expressing mTagBFP2DepositorInsertsspyCas9 sgRNA-TRAC
mTagBFP2
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterCAG and U6Available sinceJune 30, 2021AvailabilityAcademic Institutions and Nonprofits only -
pJRH056
Plasmid#171637PurposePlasmid containing a U6 promoter expressing a spyCas9 tdTom sgRNA298 and CAG promoter expressing mTagBFP2DepositorInsertsspyCas9 sgRNA-tdTomato
mTagBFP2
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterCAG and U6Available sinceJune 30, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCAT024
Plasmid#171636PurposePlasmid containing a U6 promoter expressing a spyCas9 sgRNA targeting BFP and CAG promoter expressing mTagBFP2DepositorInsertsspyCas9 sgRNA-BFP
mTagBFP2
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterCAG and U6Available sinceJuly 13, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EGFP.T2A.NCLX.3'UTR
Plasmid#181872PurposeExpresses EGFP and murine NCLX (separated by a T2A cleavage site) under control of the synthetic CAG promoter (includes a large portion of the Slc8b1 3'UTR)DepositorInsertsUseAAV and AdenoviralTagsHA, T2A, and mycExpressionMammalianMutationincludes a large portion of the Slc8b1 3'UTR…Promotersynthetic hybrid CAG promoterAvailable sinceMarch 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
pJRH-1346 U6-B2M sgRNA Gag-pol v2
Plasmid#201917PurposeCas9-EDV production plasmid. Expresses the Gag-pol (CAG promoter) and B2M sgRNA (human U6 promoter, 5’-GAGTAGCGCGAGCACAGCTA)DepositorInsertsGag-pol
B2M sgRNA (Target-specific sequence: 5'- GAGTAGCGCGAGCACAGCTA)
UseTagsExpressionMammalianMutationPromoterCAG and Human U6Available sinceAug. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCAX-SCLM
Plasmid#216757PurposeFor strong and long-lasting expression of SuperClomeleon in mammalian cells from the hybrid CAG promoterDepositorInsertSuperClomeleon
UseTagsExpressionMammalianMutationS30R and 11 AA deletion in the Cerulean CFP moiet…PromoterCAG (cytomegalovirus-chicken beta-actin-rabbit be…Available sinceApril 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
pKC-Tol2
Plasmid#85600PurposeSource of Tol2 transposase driven by a mini-CAGS promoter.DepositorInsertTol2 transposase
UseTagsExpressionMammalianMutationPromotermini-CAGAvailable sinceDec. 15, 2017AvailabilityAcademic Institutions and Nonprofits only -
pKTol2C-EGFP
Plasmid#85598PurposeTol2 transposon with EGFP driven by minimal-CAGs promoter.DepositorInsertTol2 transposon with EGFP
UseTagsExpressionMammalianMutationPromotermini-CAGAvailable sinceDec. 15, 2017AvailabilityAcademic Institutions and Nonprofits only -
pJRH-1345 U6-B2M sgRNA Gag-Cas9 v2
Plasmid#201916PurposeCas9-EDV production plasmid. Expresses the v2 Gag-Cas9 polypeptide (CAG promoter) and B2M sgRNA (human U6 promoter, 5’-GAGTAGCGCGAGCACAGCTA)DepositorInsertsGag-Cas9 v2
B2M sgRNA (Target-specific sequence: 5'- GAGTAGCGCGAGCACAGCTA)
UseTagsExpressionMammalianMutationPromoterCAG and Human U6Available sinceAug. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
pdx1-mTQ2-P2A-FlpO-PA
Plasmid#67279PurposePancreas specific expression of the FlpO recombinase controlled by the pdx1 promoter . FlpO is linked to mTQ2 -a blue fluorescent protein. The gene cassette is in a SB transposon contextDepositorInsertsmTQ2=mturquoise2 blue fluorescent gene
FlpO recombinase
UseTagslinked to FlpO through an P2A ribosomal skipping …ExpressionMammalianMutationPromoterpdxAvailable sinceJuly 15, 2015AvailabilityAcademic Institutions and Nonprofits only -
enIscB
Plasmid#205410PurposeVector encoding human codon-optimized enhanced-activity OgeuIscB driven by CAG promoter, optimized _RNA (_RNA*) driven by hU6, and mCherry driven by CMV promoterDepositorInsertpCAG_Flag_SV40NLS_OgeuIscB*_npNLS_polyA_pU6__RNA*_pCMV_mCherry
UseTagsExpressionMammalianMutationE85R+H369R+S387R+S457RPromoterCAG, hU6, CMVAvailable sinceFeb. 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
enIscB-T5E
Plasmid#205411PurposeVector encoding human codon-optimized enhanced-activity OgeuIscB fused with T5E at C-terminal driven by CAG promoter, optimized _RNA (_RNA*) driven by hU6, and mCherry driven by CMV promoterDepositorInsertpCAG_Flag_SV40NLS_OgeuIscB*_XTEN_T5E_npNLS_pU6__RNA*_pCMV_mCherry
UseTagsExpressionMammalianMutationE85R+H369R+S387R+S457RPromoterCAG, hU6, CMVAvailable sinceDec. 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
pJT87
Plasmid#204489PurposeCAG promoted WBeta recombinaseDepositorInsertWBeta recombinase
UseSynthetic BiologyTagsExpressionBacterial and MammalianMutationPromoterCAGAvailable sinceFeb. 16, 2024AvailabilityAcademic Institutions and Nonprofits only -
pJT88
Plasmid#204490PurposeCAG promoted phiC31 recombinaseDepositorInsertphiC31 recombinase
UseSynthetic BiologyTagsExpressionBacterial and MammalianMutationPromoterCAGAvailable sinceDec. 19, 2023AvailabilityAcademic Institutions and Nonprofits only -
pRegev_ExonSkip_Backbone
Plasmid#204187PurposeBackbone for cloning splicing library with truncated CAG promoter and first half of beta globin minigene reporter (exon 1 and intron 1).DepositorInsertFirst exon and intron for beta globin splicing minigene
UseTagsExpressionMammalianMutationPromoterTruncated CAGAvailable sinceAug. 14, 2023AvailabilityAcademic Institutions and Nonprofits only -
PB-FLuc+GFPd2
Plasmid#127190PurposePiggybac transposon plasmid for expression of CMV promoter firefly luciferase (FLuc) and SV40 destabilized green fluorescent protein (GFPd2)DepositorInsertFirefly luciferase
UseLuciferaseTagsExpressionMammalianMutationPromoterCMVAvailable sinceMay 28, 2020AvailabilityAcademic Institutions and Nonprofits only