We narrowed to 15,270 results for: grn
-
Plasmid#165078PurposeExpression of RfxCas13d sgRNAs from a U6 promoterDepositorPublicationHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertScaffold gRNA
ExpressionMammalianAvailable sinceJune 16, 2021AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pRetrosuper Fbw7 shRNA-1
Plasmid#15660DepositorAvailable sinceNov. 2, 2007AvailabilityIndustry, Academic Institutions, and NonprofitsCited by -
pJRH-1346 U6-B2M sgRNA Gag-pol v2
Plasmid#201917PurposeCas9-EDV production plasmid. Expresses the Gag-pol (CAG promoter) and B2M sgRNA (human U6 promoter, 5’-GAGTAGCGCGAGCACAGCTA)DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertsGag-pol
B2M sgRNA (Target-specific sequence: 5'- GAGTAGCGCGAGCACAGCTA)
ExpressionMammalianPromoterCAG and Human U6Available sinceAug. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1 Sox2 3H b
Plasmid#26352DepositorPublicationInsertSox2 shRNA
UseLentiviral and RNAiExpressionMammalianAvailable sinceSept. 22, 2010AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pEB-p53shRNA
Plasmid#28222DepositorInsertp53 shRNA
ExpressionMammalianAvailable sinceMarch 25, 2011AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pLL3.7_hsa-miR-34a
Plasmid#25791DepositorInserthsa-miR-34a (TP53 Human)
UseLentiviral and RNAiAvailable sinceJuly 13, 2010AvailabilityAcademic Institutions and Nonprofits onlyCited by -
OpenCRISPR-1 sgRNA-12nt stem
Plasmid#221567PurposeExpress OpenCRISPR-1 sgRNA (12nt stem loop) in human cells using a U6 promoter. Plasmid also encodes a CMV-driven GFP reporter.DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertOpenCRISPR-1 sgRNA 12nt stem loop
ExpressionMammalianPromoterU6Available sinceAug. 28, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits -
LL - hOCT4i -1
Plasmid#12198DepositorAvailable sinceSept. 6, 2006AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pS-sg:GFP
Plasmid#196296Purpose35S promoter-driven expression of the positive-sense TSWV S RNA segment encoding sgRNA:GFP fusion in place of viral NSsDepositorInsertFull length TSWV S antigenome encoding sgRNA:GFP fusion in place of viral NSs
UseCRISPRExpressionPlantPromoterduplicated cauliflower mosaic virus 35S promoterAvailable sinceApril 10, 2023AvailabilityAcademic Institutions and Nonprofits only -
pORANGE Tubb3-GFP KI
Plasmid#131497PurposeEndogenous tagging of β3 Tubulin: C-terminal (amino acid position: STOP codon)DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAExpressionMammalianPromoterU6 and CbhAvailable sinceSept. 20, 2019AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pLKO.1 Puro shRNA Scramble
Plasmid#162011PurposeLentiviral negative control vector containing scramble shRNADepositorInsertscramble shRNA
UseLentiviralAvailable sinceDec. 4, 2020AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pMSCV-FLIP-puro-dsRed-GFP-miRNA
Plasmid#32704DepositorInsertemGFP-miRNA
UseCre/Lox, RNAi, and RetroviralExpressionMammalianAvailable sinceDec. 13, 2011AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pLKO.1.sh.beta-catenin.2279
Plasmid#19762DepositorInsertsmall hairpin RNA against beta-catenin (CTNNB1 Human)
UseLentiviral and RNAiExpressionMammalianAvailable sinceJuly 6, 2009AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pLKO.1 puro CXCR4 siRNA-1
Plasmid#12271DepositorPublicationAvailable sinceJuly 20, 2006AvailabilityAcademic Institutions and Nonprofits onlyCited by -
LL - hOCT4i -2
Plasmid#12197DepositorAvailable sinceSept. 6, 2006AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pHSN401
Plasmid#50588PurposeCRISPR/Cas based plant genome editing and gene regulation; expresses 3×FLAG-NLS-zCas9-NLS, gRNA scaffold for insertion of target sequence (AtU6-26 promoter), Hyg resistanceDepositorInserts3×FLAG-NLS-zCas9-NLS
gRNA scaffold
UseCRISPR; Plant expressionTags3xFLAG and NLSMutationmaize codon optimizedPromoter2×35Sp and AtU6-26pAvailable sinceDec. 11, 2014AvailabilityAcademic Institutions and Nonprofits onlyCited by -
lenti-tmpknot-epegRNA-puro backbone
Plasmid#214089PurposeLentiviral backbone plasmid to insert epegRNAs (mpknot) of interest. The cloning site is BsmbI.DepositorTypeEmpty backboneUseLentiviralExpressionMammalianPromoterhU6, EF1aAvailable sinceJune 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLVUTHshGATA1-tTR-KRAB
Plasmid#11650PurposeTet-regulated (Tet-on) lentiviral vector for shGATA1 (hUbiquitin promoter) - 3rd generationDepositorInserthUbiquitin C, GFP, tTR-KRAB, shRNA against GATA1, Tet-on (GATA1 Human)
UseCre/Lox, Lentiviral, and RNAiExpressionMammalianAvailable sinceAug. 17, 2006AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pHR-UCOE-EF1a-Zim3-dCas9-P2A-GFP
Plasmid#188778PurposedCas9 with an N-term Zim3 KRAB-NLS fusion, a C-term HA-2xNLSDepositorInsertZim3-dCas9
UseLentiviralTagsHA-2xNLS and Zim3 KRAB-NLS fusionPromoterEF1aAvailable sinceOct. 18, 2022AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pJK02
Plasmid#105133PurposeClostridium difficile CRISPR-cas9 mutagenesis plasmid traJ oriTDepositorInsertsUpstream & Downstream pyrE deletion region
tetR
Cas9
gRNA
UseE. coli - c. difficile shuttle vectorAvailable sinceJan. 22, 2018AvailabilityAcademic Institutions and Nonprofits onlyCited by