We narrowed to 14,223 results for: Cas9
-
Plasmid#71516PurposeExpresses gRNA for dpy-10 conversion using NGCG PAM and VRER Cas9 mutantDepositorInsertdpy-10 gRNA
UseCRISPRExpressionWormPromoterU6Available sinceDec. 10, 2015AvailabilityAcademic Institutions and Nonprofits only -
pLV/eGFP-U6-sgRNA
Plasmid#170544PurposeA lentiviral backbone for homology directed insertion of eGFP. Containing only eGFP, flanked by restriction sites for insertion of homology arms and a sgRNA casstte to clone in sgRNA for HDRDepositorTypeEmpty backboneUseCRISPR and LentiviralAvailable sinceJan. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAEF5
Plasmid#136305PurposePlasmid encoding the Cas9 gene and a gRNA expression cassette allowing to clone a single or multiple gRNAs for DSBs induction in yeast. Constructed by Aubin FleissDepositorTypeEmpty backboneUseCRISPRAvailable sinceFeb. 17, 2020AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pRU46
Plasmid#167668PurposeENTRY vector for gRNA6 cloning under pAtU3 promoterDepositorInsertpAtU3
UseCRISPRAvailable sinceJuly 20, 2021AvailabilityAcademic Institutions and Nonprofits only -
sg14x(MS2) MUC4.1
Plasmid#101153PurposegRNA with 14 MCP binding siteDepositorInsertMUC4 (MUC4 Human)
UseCRISPR and LentiviralAvailable sinceNov. 9, 2017AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pLKO.1-puro U6 sgRNA Oct4A -158
Plasmid#50922PurposeU6 driven sgRNA targeting OCT4 isoform A -158 bp from TSSDepositorAvailable sinceJan. 22, 2014AvailabilityAcademic Institutions and Nonprofits only -
pYTK-DN4
Plasmid#180285PurposeKanR multi-gene yeast expression vector (GFP-dropout)DepositorInsertConLS' - GFP - ConRE' - KanR - CEN6/ARS4
ExpressionBacterial and YeastAvailable sinceJune 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
Level 1 P4 TaU6 guide acceptor
Plasmid#165600PurposeGoldenGate (MoClo) Level 1 Position 4 TaU6 guide acceptor plasmidHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertTaU6 promoter::LacZ::sgRNA scaffold
UseCRISPR and Synthetic Biology; Sgrna acceptor with…Available sinceApril 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
Level 1 P3 TaU6 guide acceptor
Plasmid#165599PurposeGoldenGate (MoClo) Level 1 Position 3 TaU6 guide acceptor plasmidHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertTaU6 promoter::LacZ::sgRNA scaffold
UseCRISPR and Synthetic Biology; Sgrna acceptor with…Available sinceApril 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pFH6_new
Plasmid#105866Purposemore efficient version of pFH6; Subcloning of any sgRNA via BbsI siteDepositorInsertU6-26p::sgRNA scaffold
UseCRISPR and Synthetic Biology; SubcloningExpressionPlantAvailable sinceApril 27, 2018AvailabilityAcademic Institutions and Nonprofits only -
pX330A_FokI-1x2
Plasmid#63602PurposeExpresses FokI-dCas9 and gRNADepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertFokI-dCas9
UseCRISPRExpressionMammalianPromoterCBhAvailable sinceJune 1, 2015AvailabilityAcademic Institutions and Nonprofits only -
pCfB3042(gRNA X-4)
Plasmid#73284PurposeEasyClone-MarkerFree guiding RNA vector to direct Cas9 to cut at site X-2DepositorInsertguiding RNA
UseCRISPR; GrnaExpressionYeastAvailable sinceNov. 23, 2016AvailabilityAcademic Institutions and Nonprofits only -
pJAT10
Plasmid#204293PurposeFor marking CRISPR HDR integrant with DsRed expressed in flight muscles.DepositorPublicationHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertMHC-DsRed
UseCRISPRPromoterMHCAvailable sinceAug. 29, 2023AvailabilityAcademic Institutions and Nonprofits only -
Nme2sgRNA_pLKO
Plasmid#119926PurposeNme2Cas9 U6-driven sgRNA cassetteDepositorInsertNmeCas9 sgRNA
UseLentiviralExpressionMammalianPromoterU6Available sinceJan. 23, 2019AvailabilityAcademic Institutions and Nonprofits only -
pYPQ135A
Plasmid#69277PurposeGolden Gate entry vector; 5th gRNA under AtU6 promoterDepositorTypeEmpty backboneUseCRISPRAvailable sinceSept. 14, 2015AvailabilityAcademic Institutions and Nonprofits only -
pYPQ141C
Plasmid#69292PurposeGateway entry vector; single gRNA under OsU6 promoterDepositorTypeEmpty backboneUseCRISPRAvailable sinceSept. 14, 2015AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pAAV-SCP1-dSa VPR mini.-2X snRP-1 Neurog2
Plasmid#99694PurposeExpresses dSa Cas9 fused to optimized combination of truncated activation domains from SCP1 promoter with dual snRP1 poly adenylation signal, and Sa sgRNA for Actc1, vector allows for strong activation of mouse Actc1, can be packaged and delivered as AAVDepositorPublicationInsertdCas9 and gRNA targeting Actc1 (gRNA: GGTATATAAGGGGTTTTAAG) (Actc1 Mouse, Synthetic)
UseAAV and CRISPRTagsVPR miniMutationdead Cas9Available sinceJan. 16, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCfB6677
Plasmid#106155PurposeEasyCloneYALI system-based yeast integrative vector for markerfree integration via CRISPR/Cas9 to be used in combination with pCfB6632, integration into Yarrowia lipolytica chromosomal location IntE_1, USER site for cloning, amp resistanceDepositorTypeEmpty backboneExpressionYeastAvailable sinceMay 11, 2018AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pTX209
Plasmid#89269PurposeExpress STU Cas9 with Maize Ubiquitin1 promoter in rice targeting OsPDS gene, OsPDS-gRNA01 and OsPDS-gRNA02DepositorInsertOsPDS-gRNA01 and OsPDS-gRNA02
UseCRISPRTagsSV40 NLSExpressionPlantPromoterMaize Ubiquitin1 promoterAvailable sinceMay 8, 2017AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pLV.5’VIM-eGFP-KI
Plasmid#170547PurposeExpresses a sgRNA for 5' tagging to VIM and contains a cassette with eGFP flanked by homology arms for VIMDepositorInsertsLeft Homology arm for VIM knockin
Right Homology arm for VIM knockin
UseCRISPR and LentiviralAvailable sinceJan. 12, 2024AvailabilityAcademic Institutions and Nonprofits only