We narrowed to 6,227 results for: KIT
-
Plasmid#178726PurposeAAV vector for Cre- and Flp-dependent transgene expression (CRE-OFF / FLP-ON) of ChR2-YFP in neurons under the control of the hSyn1 promoter (Kugler et al 2003)DepositorInsertChR2-YFP
UseAAVAvailable SinceMay 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-VTKD6-V5-APEX2-NES
Plasmid#178700PurposeAAV vector for Cre- and Flp-dependent transgene expression (CRE-OFF / FLP-ON) of V5-APEX2-NES in cortical interneurons under the control of the Dlx enhancer (Dimidschstein et al 2016)DepositorInsertV5-APEX2-NES
UseAAVAvailable SinceMay 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-VTKS3-TeTLc-P2A-mCherry
Plasmid#178708PurposeAAV vector for Flp-dependent transgene expression of TeTLc-P2A-mCherry in neurons under the control of the hSyn1 promoter (Kugler et al 2003)DepositorInsertTeTLc-P2A-mCherry
UseAAVAvailable SinceMay 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-VTKD4-V5-APEX2-NES
Plasmid#178698PurposeAAV vector for Cre- and Flp-dependent transgene expression (CRE-ON / FLP-ON) of V5-APEX2-NES in cortical interneurons under the control of the Dlx enhancer (Dimidschstein et al 2016)DepositorInsertV5-APEX2-NES
UseAAVAvailable SinceMay 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-VTKD5-V5-APEX2-NES
Plasmid#178699PurposeAAV vector for Cre- and Flp-dependent transgene expression (CRE-ON / FLP-OFF) of V5-APEX2-NES in cortical interneurons under the control of the Dlx enhancer (Dimidschstein et al 2016)DepositorInsertV5-APEX2-NES
UseAAVAvailable SinceMay 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
DHC1-mIAA17 Hygro
Plasmid#140544PurposeDHC1 tagging with mIAA7DepositorAvailable SinceNov. 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-R-ARS805a
Plasmid#87408Purposep426_Cas9_gRNA-ARS805a without ribozyme All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS805a sequence TTATTTGAATGATATTTAGT in yeast chromosome 8.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS805a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCAG-MCP-dNS-SRRM1-V5-mCherry
Plasmid#235095PurposeSRRM1 lacking Nuclear Speckle domain (dNS-SRRM1) mCherry fusion protein with MCP domainDepositorInsertpCAG-MCP-dNS-SRRM1-V5-mCherry (SRRM1 Human)
ExpressionMammalianMutationThe SRRM1 entry clone from DNASU was modified usi…PromoterCAGAvailable SinceMay 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCAG-SpyTag-Flag-dNS-SRRM1-V5-mCherry
Plasmid#235096PurposeSRRM1 lacking Nuclear Speckle domain (dNS-SRRM1) mCherry fusion protein without MCP domainDepositorInsertpCAG-SpyTag-Flag-dNS-SRRM1-V5-mCherry (SRRM1 Human)
ExpressionMammalianMutationThe SRRM1 entry clone from DNASU was modified usi…PromoterCAGAvailable SinceApril 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
pGL4-AARE-luc2P-Hygro
Plasmid#101787PurposeLuferase reporter plasmid containing three tandem repeats of the amino acid response element (AARE)DepositorInsert3xAARE
UseLuciferaseTagsLuciferaseExpressionMammalianPromoterminimal TATA-box promoter with low basal activityAvailable SinceSept. 27, 2017AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1 FFSS-BACH1
Plasmid#232273PurposeExpression of N-terminal tagged 2xFLAG-2xSTREP-BACH1 (H. sapiens) in human cell linesDepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
CAG-Cas9-T2A-EGFP-ires-puro
Plasmid#78311PurposeExpresses WT SpCas9, EGFP and Puromycin resistance from a CAG promoter.DepositorInsertWT SpCas9-T2A-EGFP-ires-puromycin resistance
UseCRISPRTagsT2A-EGFP-ires-puroExpressionMammalianPromoterCAGAvailable SinceApril 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
pSLPB2B-FKBP12_F36V-SpdCas9-tagRFPt-P2A-tagBFP-PGK-Blasticidin
Plasmid#187951PurposeFKBP12 (F36V mutant) degron-tagged dCas9 fused with tagRFPt, P2A site and tagBFP, expressed under EF1-alpha promoter in a piggyBac plasmid. Expresses Blasticidin resistance under PGK promoter.DepositorInsertFKBP12_F36V-SpdCas9-tagRFPt-P2A-tagBFP
UseCRISPR and Synthetic BiologyTagsGGS linkerExpressionMammalianAvailable SinceOct. 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
pMK297 (DHC1-mAID Hygro)
Plasmid#140542PurposeDHC1 tagging with mAIDDepositorAvailable SinceNov. 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
pMK296 (DHC1-mAID Neo)
Plasmid#140541PurposeDHC1 tagging with mAIDDepositorAvailable SinceNov. 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
pGL3-Basic-Rab18-sfGFP(N) HDR template
Plasmid#129415PurposeHDR tempalte for tagging of endogenous human RAB18 N-terminus with sfGFPDepositorInsertRAB18 HDR template (RAB18 Human)
UseCRISPR and TALEN; Endogenous tagging hdr templateTagssfGFPExpressionMammalianAvailable SinceAug. 22, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV Jph3gRNA mEmerald hSyn mTagBFP2-CAAX2
Plasmid#236246PurposeEndogenous tagging of Junctophilin 3 with mEmerald with a fluorescent marker for the plasma membraneDepositorInsertgRNA for rat Jph3, mEmerald donor and mTagBFP2-CAAX2
UseAAVTagsmTagBFP2PromoterU6 and human Synapsin1Available SinceMay 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
LMPd Amt OXCT1
Plasmid#209407PurposeRetroviral vector with Ametrine marker for expressing shRNA with an "UltramiR" microRNA scaffoldDepositorInsertOxct1 shRNA (Oxct1 Mouse)
UseRetroviralAvailable SinceNov. 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV hSyn INTRON mTagBFP2-CAAX2 WPRE
Plasmid#236231PurposeAAV expression of a fluorescent marker, mTagBFP2, fused to the plasma membrane targeting sequence CAAX2DepositorInsertmTagBFP2 fused to the plasma membrane targeting sequence CAAX2
UseAAVTagsmTagBFP2Promoterhuman Synapsin 1Available SinceMay 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-mGFAP(ABC1D)-2pabPAC(F198Y)
Plasmid#234548Purposeto express a version with reduced constitutive activity (thanks to point mutation F198Y) of the optogenetic tool 2pabPAC, which increases cAMP levels when stimulated by blue light, in astrocytesDepositorInsert2pabPAC(F198Y)
UseAAVMutationF198YPromotermGFAP(ABC1D)Available SinceJuly 2, 2025AvailabilityAcademic Institutions and Nonprofits only