We narrowed to 6,201 results for: org
-
Plasmid#131785PurposeAAV donor/transfer vector expressing CreLite system components, PhyBΔCreC and PIF6CreN, driven by CBh promoterDepositorInsertPhyBCreC-P2A-PIF6CreN
UseAAV, Cre/Lox, and Synthetic BiologyExpressionMammalianPromoterCBhAvailable SinceJan. 9, 2020AvailabilityAcademic Institutions and Nonprofits only -
pDEST27-GST-hMSN
Plasmid#211823PurposeExpress human MSN in mammalian cellsDepositorAvailable SinceJan. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-lincRNA-RoR-sh1 (Linc-sh1)
Plasmid#45764DepositorAvailable SinceAug. 12, 2013AvailabilityAcademic Institutions and Nonprofits only -
K15-TK/pGL3
Plasmid#44267DepositorInsertK15 promoter (-4.8) (Krt15 Mouse)
UseMouse Targeting; Thymidine kinaseTagsHSV-1 TKExpressionMammalianMutationContains the murine K15 promoter (-4.8) fragmentPromotermurine K15 promoter (-4.8) fragmentAvailable SinceApril 2, 2013AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-lincRNA-RorR-sh2 (Linc-sh2)
Plasmid#45765DepositorAvailable SinceAug. 12, 2013AvailabilityAcademic Institutions and Nonprofits only -
pTol2-PcyA-IRES-HO1
Plasmid#131787PurposeTol2 bicistronic vector expressing PcyA and HO1 for Phycocyanobilin (PCB) synthesis, driven by heatshock promoter hsp70.DepositorInsertPcyA and HO1
UseSynthetic Biology; Zebrafish tol2 transposonTagsMTS (Mitochondrial Targeting Signal from subunit …ExpressionMammalianPromoterhsp70Available SinceJan. 9, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-dSa VP64 Actc1
Plasmid#99691PurposeExpresses dSa Cas9 fused to gold standard VP64 activator domain and Sa sgRNA for Actc1 promoter, vector allows for activation of mouse Actc1, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Actc1 (gRNA sequence: GCCATTCTTGGAGCCAAGGG) (Actc1 Synthetic, Mouse)
UseAAV and CRISPRTagsVP64Mutationdead Cas9Available SinceDec. 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
sgFFL_3x_siRNA
Plasmid#59893Purposesynthetic autoregulatory gene circuit made by inserting an intron containing the mouse mir-124–3 gene into mCherry. Contains the miR-124-regulated 3′UTR of the Vamp3 gene with three siRNA-like sitesDepositorInsertmCherry with intron containing the mouse mir-124–3
TagsPEST and VAMP 3 UTRExpressionMammalianMutationVAMP 3 UTR--has three siRNA-like targets (fully c…Promoterdoxycycline (Dox)-inducible promoter (CMV/TO)Available SinceApril 1, 2015AvailabilityAcademic Institutions and Nonprofits only -
pKlab813-bGlobin_3xF-BRCA1(full-length)-Y1845D
Plasmid#249024PurposeThis plasmid expresses the full length BRCA1 sequence (Y1845D mutation) with an N-terminal 3xFLAG tagDepositorInsertBRCA1 (BRCA1 Human)
Tags3x-FLAG-V5ExpressionMammalianMutationY1845DPromoterCMV PromoterAvailable SinceJan. 21, 2026AvailabilityAcademic Institutions and Nonprofits only -
pKlab814-bGlobin_3xF-BRCA1(full-length)-M1775R
Plasmid#249025PurposeThis plasmid expresses the full length BRCA1 sequence (M1775R mutation) with an N-terminal 3xFLAG tagDepositorInsertBRCA1 (BRCA1 Human)
Tags3x-FLAG-V5ExpressionMammalianMutationM1775RPromoterCMV PromoterAvailable SinceJan. 21, 2026AvailabilityAcademic Institutions and Nonprofits only -
pKlab816-bGlobin_3xF-BRCA1(full-length)-G1788V
Plasmid#249026PurposeThis plasmid expresses the full length BRCA1 sequence (G1788V mutation) with an N-terminal 3xFLAG tagDepositorInsertBRCA1 (BRCA1 Human)
Tags3x-FLAG-V5ExpressionMammalianMutationG1788VPromoterCMV PromoterAvailable SinceJan. 21, 2026AvailabilityAcademic Institutions and Nonprofits only -
pKlab818-bGlobin_3xF-BRCA1(full-length)-A1708E
Plasmid#249027PurposeThis plasmid expresses the full length BRCA1 sequence (A1708E mutation) with an N-terminal 3xFLAG tagDepositorInsertBRCA1 (BRCA1 Human)
Tags3x-FLAG-V5ExpressionMammalianMutationA1708EPromoterCMV PromoterAvailable SinceJan. 21, 2026AvailabilityAcademic Institutions and Nonprofits only -
pKlab819-bGlobin_3xF-BRCA1(full-length)-Y1845F
Plasmid#249028PurposeThis plasmid expresses the full length BRCA1 sequence (Y1845F mutation) with an N-terminal 3xFLAG tagDepositorInsertBRCA1 (BRCA1 Human)
Tags3x-FLAG-V5ExpressionMammalianMutationY1845FPromoterCMV PromoterAvailable SinceJan. 21, 2026AvailabilityAcademic Institutions and Nonprofits only -
pKlab187-pcDNA3-BRCA1(1314-end)-WT-V5-3xFLAG
Plasmid#249013PurposeThis plasmid expresses the C-terminally 3x-FLAG tagged BRCT domainDepositorAvailable SinceJan. 21, 2026AvailabilityAcademic Institutions and Nonprofits only -
pKlab966-pUC19-HAL-BRCA1-BSD-P2A-2xHA-FKBP12-F36V-HAR-BRCA1
Plasmid#249004PurposeThis plasmid expresses the degron tag knock-in sequence at the N-terminus of the endogenous BRCA1 locusDepositorAvailable SinceJan. 21, 2026AvailabilityAcademic Institutions and Nonprofits only -
GFP-CDKL5(isoform-2)
Plasmid#245901PurposeMammalian expression of CDKL5 isoform2 (1-1030) with N-terminal GFPDepositorAvailable SinceNov. 7, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
GFP-CDKL5(kinase)
Plasmid#245902PurposeMammalian expression of CDKL5 kinase domain (1-311) with N-terminal GFPDepositorAvailable SinceNov. 7, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
CDKL5(isoform1)-GFP
Plasmid#245903PurposeMammalian expression of CDKL5 isoform1 (1-960) with C-terminal GFPDepositorAvailable SinceOct. 23, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
pREC1010-opEas1
Plasmid#240701PurposeRSF1010 origin of replication plasmid containing Eas1 recombitron with extended a1 a2 regions in the ncRNA targeting lacZ locus in Klebsiella pneumoniae ATCC 10031 expressed by Pm promoterDepositorInsertEas1 RT, Eas1 ncRNA, CspRecT and EcSSB
ExpressionBacterialMutationExtended a1 a2 regionsAvailable SinceOct. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pZac2.1-GfaABC1D-2xEzrin-BioID2-HA
Plasmid#227681PurposeTo over express 2x Ezrin under gfaABC1D promoter in astrocytesDepositorAvailable SinceOct. 1, 2025AvailabilityAcademic Institutions and Nonprofits only