We narrowed to 733 results for: Tcta
-
Plasmid#227458Purpose6-mer gRNA array targeting Sp dCas9/Cas9 to the Prdm8-Fgf5 locusDepositorInsertCARGO to 55kb Upstream Fgf5
UseCRISPRTagsExpressionMutationPromoterAvailable SinceMay 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pk335-CARGO-6mer-7.5kb-USP
Plasmid#227448Purpose6-mer gRNA array targeting Sp dCas9/Cas9 to the Prdm8-Fgf5 locusDepositorInsertCARGO to 7.5kb Upstream Prdm8
UseCRISPRTagsExpressionMutationPromoterAvailable SinceMay 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-CAN1y
Plasmid#87391PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting CAN1y sequence GATACGTTCTCTATGGAGGA in yeast chromosome 6.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting CAN1y
UseCRISPRTagsExpressionMutationPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLCHKO_SFRS7_exon_deletion_3
Plasmid#155071PurposeLentiviral plasmid for expressing U6 driven hybrid guide (hg)RNA for deletion of SFRS7 exon using SpCas9 and LbCas12a nucleases (CHyMErA system)DepositorInsert(hg)RNA for deletion of SFRS7 exon using SpCas9 and LbCas12a nucleases
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterU6Available SinceAug. 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
pk335-CARGO-11mer-35kb-DSF-1-11
Plasmid#227489Purpose11-mer gRNA array targeting Sp dCas9/Cas9 to the Prdm8-Fgf5 locusDepositorInsertCARGO to 35kb Downstream Fgf5
UseCRISPRTagsExpressionMutationPromoterAvailable SinceMay 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
lentiGuide-puro_Panc480-MT7
Plasmid#200941PurposeMultiplexed CRISPR array expressing 7 sgRNA in a lentiviral backboneDepositorInsertmultiplexed sgRNA array
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterhU6, EF-1aAvailable SinceJuly 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
pROS13-Tps2/Gsy1
Plasmid#196613PurposeEncoding guide RNAs for the knock out of TPS2 and GSY1 genesDepositorAvailable SinceMarch 15, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLCHKO_SFRS7_exon_deletion_2
Plasmid#155070PurposeLentiviral plasmid for expressing U6 driven hybrid guide (hg)RNA for deletion of SFRS7 exon using SpCas9 and LbCas12a nucleases (CHyMErA system)DepositorInsert(hg)RNA for deletion of SFRS7 exon using SpCas9 and LbCas12a nucleases
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterU6Available SinceAug. 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLCHKO_Ptbp_ex8_4
Plasmid#155084PurposeLentiviral plasmid for expressing U6 driven hybrid guide (hg)RNA for deletion of mouse Ptbp exon 8 using SpCas9 and LbCas12a nucleases (CHyMErA system)DepositorInsert(hg)RNA for deletion of mouse Ptbp exon 8 using SpCas9 and LbCas12a nucleases
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterU6Available SinceAug. 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
gh146
Plasmid#106805Purposeexpression of gRNA targeting FKTNDepositorAvailable SinceApril 29, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLCHKOv3-CD46 Ex3_3-Lb
Plasmid#209029PurposeLentiviral vector expressing U6 driven hybrid guide (hgRNA) targeting human CD46 Exon 3 for deletion using SpCas9 and LbCas12a nucleases (CHyMErA system)DepositorInserthgRNA for deletion of CD46 Exon 3 with SpCas9 tracrRNAv1 & LbCas12a DR
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterU6Available SinceJune 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLCHKOv3-CD46 Ex3_3-As
Plasmid#209033PurposeLentiviral vector expressing U6 driven hybrid guide (hgRNA) targeting human CD46 Exon 3 for deletion using SpCas9 and AsCas12a nucleases (CHyMErA system)DepositorInserthgRNA for deletion of CD46 Exon 3 with SpCas9 tracrRNAv1 & AsCas12a DR
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterU6Available SinceJune 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
pFlare9A-Clip2E9 Mutant
Plasmid#209575Purposeminigene construct for Clip2 E9 alternative splicing, potential PTBP2 binding sites are deletedDepositorInsertClip2 (Clip2 Mouse)
UseTagsExpressionMammalianMutationACGCGTTTCTGAATTCTTCTAACTGCCCTCAAATGCACGGTGGCATGTG…PromoterCMVAvailable SinceMarch 7, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLCHKO_TK1_HPRT1_Lb_2
Plasmid#155060PurposeLentiviral plasmid for expressing U6 driven multiplexed hybrid guide (hg)RNA targeting TK1 using SpCas9 and an intergenic site & HPRT1 using LbCas12a (CHyMErA system)DepositorInsert(hg)RNA targeting TK1 using SpCas9 and two intergenic sites & HPRT1 using LbCas12a
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterU6Available SinceAug. 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV CAG Barcode7
Plasmid#229069PurposeExpression mappingDepositorInsertCAG Barcode7
UseAAVTagsExpressionMutationPromoterAvailable SinceDec. 3, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV Syn Barcode15
Plasmid#226189PurposeExpression mappingDepositorInsertSyn Barcode15
UseAAVTagsExpressionMutationPromoterAvailable SinceOct. 4, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV Syn Barcode14
Plasmid#226188PurposeExpression mappingDepositorInsertSyn Barcode14
UseAAVTagsExpressionMutationPromoterAvailable SinceOct. 4, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV Syn Barcode13
Plasmid#226187PurposeExpression mappingDepositorInsertSyn Barcode13
UseAAVTagsExpressionMutationPromoterAvailable SinceOct. 4, 2024AvailabilityAcademic Institutions and Nonprofits only -
pOpen-XbaIR
Plasmid#165567PurposeType II restriction enzyme that recognizes the double-stranded sequence TCTAGA and cleaves after T-1.DepositorInsertXbaI
UseSynthetic BiologyTagsExpressionMutationPromoterAvailable SinceAug. 18, 2021AvailabilityIndustry, Academic Institutions, and Nonprofits -
pAAV Syn Barcode20
Plasmid#226192PurposeExpression mappingDepositorInsertSyn Barcode20
UseAAVTagsExpressionMutationPromoterAvailable SinceOct. 30, 2024AvailabilityAcademic Institutions and Nonprofits only