We narrowed to 53 results for: gag pol vector
-
Plasmid#68876PurposeCHD5 shRNA expressed from Adeno-associated viral (AAV) vectorDepositorInsertCHD5
UseAAV and RNAiExpressionMammalianPromoterH1Available SinceSept. 17, 2015AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPRv2_RB1#1
Plasmid#174150PurposeLentiviral vector expressing Cas9 and a sgRNA against the human RB1 geneDepositorInsertRB1 sgRNA
UseCRISPR and LentiviralExpressionMammalianPromoterhU6Available SinceSept. 10, 2021AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPRv2_sgCtrl#1
Plasmid#174148PurposeLentiviral vector expressing Cas9 and a control sgRNA that targets a safe harbor siteDepositorInsertControl sgRNA
UseCRISPR and LentiviralExpressionMammalianPromoterhU6Available SinceSept. 10, 2021AvailabilityAcademic Institutions and Nonprofits only -
pKHH030_sgCtrl#1
Plasmid#174142PurposeLentiviral vector expressing a control sgRNA that targets a safe harbor siteDepositorInsertControl sgRNA
UseCRISPR and LentiviralExpressionMammalianPromoterhU6Available SinceSept. 13, 2021AvailabilityAcademic Institutions and Nonprofits only -
pKHH030_sgRB1#2
Plasmid#174145PurposeLentiviral vector expressing a sgRNA against the human RB1 geneDepositorInsertRB1 sgRNA
UseCRISPR and LentiviralExpressionMammalianPromoterhU6Available SinceSept. 13, 2021AvailabilityAcademic Institutions and Nonprofits only -
pSUPERretro-Sirt7 shRNA2
Plasmid#53145PurposeshRNAi vector for Sirt7DepositorInsertSirt7
UseRNAi and RetroviralExpressionMammalianPromoterH1 RNA polymerase IIIAvailable SinceMay 9, 2014AvailabilityAcademic Institutions and Nonprofits only -
pSUPERretro-Sirt7 shRNA1
Plasmid#53144PurposeshRNAi vector for Sirt7DepositorInsertSirt7
UseRNAi and RetroviralExpressionMammalianPromoterH1 RNA polymerase IIIAvailable SinceMay 9, 2014AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPRv2_AMBRA1#2
Plasmid#174153PurposeLentiviral vector expressing Cas9 and a sgRNA against the human AMBRA1 geneDepositorAvailable SinceSept. 10, 2021AvailabilityAcademic Institutions and Nonprofits only -
pKHH030_sgAMBRA1#2
Plasmid#174147PurposeLentiviral vector expressing a sgRNA against the human AMBRA1 geneDepositorAvailable SinceSept. 13, 2021AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPRv2_RB1#2
Plasmid#174151PurposeLentiviral vector expressing Cas9 and a sgRNA against the human RB1 geneDepositorAvailable SinceSept. 10, 2021AvailabilityAcademic Institutions and Nonprofits only -
pKHH030_sgRB1#1
Plasmid#174144PurposeLentiviral vector expressing a sgRNA against the human RB1 geneDepositorAvailable SinceSept. 13, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAcUW51-gEgIL
Plasmid#11622DepositorInsertHSV-1 glycoprotein E and HSV-1 glycoprotein I
TagsHisExpressionInsectMutationDicistronic vector containing HSV-1 gE (KOS straiā¦Available SinceApril 6, 2007AvailabilityAcademic Institutions and Nonprofits only -
pAAV-SCP1-dSa VPR mini.-2X snRP-1 Actc1
Plasmid#99690PurposeExpresses dSa Cas9 fused to optimized combination of truncated activation domains from SCP1 promoter with dual snRP1 poly adenylation signal, and Sa sgRNA for Actc1, vector allows for strong activation of mouse Actc1, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Actc1 (gRNA sequence: GCCATTCTTGGAGCCAAGGG ) (Actc1 Synthetic, Mouse)
UseAAV and CRISPRTagsVPR miniMutationdead Cas9Available SinceSept. 12, 2018AvailabilityAcademic Institutions and Nonprofits only