We narrowed to 10,848 results for: ENA
-
Plasmid#146042PurposeInsect Expression of DmTral-D30KT35ADepositorInsertDmTral-D30KT35A (tral Fly)
UseTagsExpressionInsectMutationtwo silent mutations A198C, A387G and a mutation …PromoterAvailable sinceFeb. 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAc5.1B-EGFP-DmTral-del46-60_C
Plasmid#146043PurposeInsect Expression of DmTral-del46-60DepositorInsertDmTral-del46-60 (tral Fly)
UseTagsExpressionInsectMutationtwo silent mutations A198C, A387G and a mutation …PromoterAvailable sinceFeb. 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAc5.1B-EGFP-DmTral-F44A_C
Plasmid#146044PurposeInsect Expression of DmTral-F44ADepositorInsertDmTral-F44A (tral Fly)
UseTagsExpressionInsectMutationtwo silent mutations A198C, A387G and a mutation …PromoterAvailable sinceFeb. 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAc5.1B-EGFP-DmTral-K73AD74A_C
Plasmid#146045PurposeInsect Expression of DmTral-K73AD74ADepositorInsertDmTral-K73AD74A (tral Fly)
UseTagsExpressionInsectMutationtwo silent mutations A198C, A387G and a mutation …PromoterAvailable sinceFeb. 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAc5.1B-EGFP-DmTral-R42E_B
Plasmid#145988PurposeInsect Expression of DmTral-R42EDepositorInsertDmTral-R42E (tral Fly)
UseTagsExpressionInsectMutationtwo silent mutations A198C, A387G and a mutation …PromoterAvailable sinceMay 17, 2021AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPR v2-sgAMPK alpha2 clone2
Plasmid#162123PurposeLentiviral sgRNA plasmid targeting human AMPK alpha2DepositorInsertsgAMPK alpha2 (PRKAA2 Human)
UseLentiviralTagsExpressionMutationPromoterAvailable sinceFeb. 16, 2021AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPR v2-sgAMPK alpha2 clone3
Plasmid#162124PurposeLentiviral sgRNA plasmid targeting human AMPK alpha2DepositorInsertsgAMPK alpha2 (PRKAA2 Human)
UseLentiviralTagsExpressionMutationPromoterAvailable sinceJan. 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1_ 2xFLAG-2xSTREP_BACH1_Y11A
Plasmid#159131PurposeExpresses BACH1 in mammalian cellsDepositorInsertBACH1 (BACH1 Human)
UseTags2X-FLAG _ 2X-STREPExpressionMammalianMutationY11APromoterCMVAvailable sinceSept. 18, 2020AvailabilityAcademic Institutions and Nonprofits only -
YCplac33-NAT_MCART1K91A
Plasmid#140592PurposeExpress MCART1K91A in S. cerevisiaeDepositorInsertSLC25A51 with 5' and 3' UTR of scNDT1 (SLC25A51 Human)
UseTagsExpressionYeastMutationcodon-optimized for expression in S. cerevisiae; …PromoterNDT1 promoter and 3'UTRAvailable sinceSept. 11, 2020AvailabilityAcademic Institutions and Nonprofits only -
AAVS1 intron 1 gRNA s3
Plasmid#132395PurposeTargets AAVS1 intron 1, gRNA: GGGGCCACTAGGGACAGGAT, MLM3636 backboneDepositorInsertgRNA targeting AAVS1 intron 1 (PPP1R12C Human)
UseCRISPRTagsExpressionMammalianMutationPromoterhU6Available sinceMay 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(Slc25a51-g1)-PGKpuroBFP-W
Plasmid#105028PurposeLentiviral gRNA plasmid targeting mouse Slc25a51 , co-expression of TagBFPDepositorInsertSlc25a51 (Slc25a51 Mouse)
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterU6Available sinceSept. 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(Slc25a51-g2)-PGKpuroBFP-W
Plasmid#105029PurposeLentiviral gRNA plasmid targeting mouse Slc25a51 , co-expression of TagBFPDepositorInsertSlc25a51 (Slc25a51 Mouse)
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterU6Available sinceSept. 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(Pou5f1-g1)-PGKpuroBFP-W
Plasmid#105035PurposeLentiviral gRNA plasmid targeting mouse Pou5f1 , co-expression of TagBFPDepositorInsertPou5f1 (Pou5f1 Mouse)
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterU6Available sinceSept. 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(Kcmf1-g1)-PGKpuroBFP-W
Plasmid#105017PurposeLentiviral gRNA plasmid targeting mouse Kcmf1 , co-expression of TagBFPDepositorInsertKcmf1 (Kcmf1 Mouse)
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterU6Available sinceSept. 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
LSB-hsa-miR-27a-5p
Plasmid#103382PurposeUsed to sense miRNA activity using fluorescence based tools. hsa-miR-27a-5p target in 3' UTR of of mKate. miRNA activity can be measured by the repression of mKate2 relative to EBFP2 fluorescent proteins . Plasmid is inherently unstable; please see Depositor CommentsDepositorInserthsa-miR-27a-5p target (MIR27A Human)
UseSynthetic BiologyTagsExpressionMammalianMutationPromoterEF-1aAvailable sinceDec. 3, 2018AvailabilityAcademic Institutions and Nonprofits only -
LSB-hsa-miR-30c-2-3p
Plasmid#103414PurposeUsed to sense miRNA activity using fluorescence based tools. hsa-miR-30c-2-3p target in 3' UTR of of mKate. miRNA activity can be measured by the repression of mKate2 relative to EBFP2 fluorescent proteins . Plasmid is inherently unstable; please see Depositor CommentsDepositorInserthsa-miR-30c-2-3p target (MIR30C2 Human)
UseSynthetic BiologyTagsExpressionMammalianMutationPromoterEF-1aAvailable sinceDec. 3, 2018AvailabilityAcademic Institutions and Nonprofits only -
LSB-hsa-miR-96-3p
Plasmid#103760PurposeUsed to sense miRNA activity using fluorescence based tools. hsa-miR-96-3p target in 3' UTR of of mKate. miRNA activity can be measured by the repression of mKate2 relative to EBFP2 fluorescent proteins . Plasmid is inherently unstable; please see Depositor CommentsDepositorInserthsa-miR-96-3p target (MIR96 Human)
UseSynthetic BiologyTagsExpressionMammalianMutationPromoterEF-1aAvailable sinceNov. 26, 2018AvailabilityAcademic Institutions and Nonprofits only -
LSB-hsa-miR-98-3p
Plasmid#103762PurposeUsed to sense miRNA activity using fluorescence based tools. hsa-miR-98-3p target in 3' UTR of of mKate. miRNA activity can be measured by the repression of mKate2 relative to EBFP2 fluorescent proteins . Plasmid is inherently unstable; please see Depositor CommentsDepositorInserthsa-miR-98-3p target (MIR98 Human)
UseSynthetic BiologyTagsExpressionMammalianMutationPromoterEF-1aAvailable sinceNov. 26, 2018AvailabilityAcademic Institutions and Nonprofits only -
LSB-hsa-miR-98-5p
Plasmid#103763PurposeUsed to sense miRNA activity using fluorescence based tools. hsa-miR-98-5p target in 3' UTR of of mKate. miRNA activity can be measured by the repression of mKate2 relative to EBFP2 fluorescent proteins . Plasmid is inherently unstable; please see Depositor CommentsDepositorInserthsa-miR-98-5p target (MIR98 Human)
UseSynthetic BiologyTagsExpressionMammalianMutationPromoterEF-1aAvailable sinceNov. 26, 2018AvailabilityAcademic Institutions and Nonprofits only -
LSB-hsa-miR-99b-3p
Plasmid#103766PurposeUsed to sense miRNA activity using fluorescence based tools. hsa-miR-99b-3p target in 3' UTR of of mKate. miRNA activity can be measured by the repression of mKate2 relative to EBFP2 fluorescent proteins . Plasmid is inherently unstable; please see Depositor CommentsDepositorInserthsa-miR-99b-3p target (MIR99B Human)
UseSynthetic BiologyTagsExpressionMammalianMutationPromoterEF-1aAvailable sinceNov. 26, 2018AvailabilityAcademic Institutions and Nonprofits only