We narrowed to 19,540 results for: INO
-
Plasmid#184528PurposeExpression of YAP1 S127ADepositorAvailable SinceJune 8, 2022AvailabilityAcademic Institutions and Nonprofits only
-
pAP05
Plasmid#186261PurposesfGFP under light light responsive PEL222 promoter and EL222 under constitutively active BBa_J2305 promoterDepositorInsertsExpressionBacterialPromoterBBa_23105 (GGCTAGCTCAGTCCTAGGTACTATGCTAGC) and PE…Available SinceSept. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCMV5B-HA-Smad2
Plasmid#11734DepositorAvailable SinceAug. 3, 2006AvailabilityIndustry, Academic Institutions, and Nonprofits -
Polymerase expression - pCMV-Phi29 (LM2708)
Plasmid#208965PurposeUnfused Phi29 DNA polymerase (-exo), expressed from CMV or T7 promoters.DepositorInsertPhi29-BPNLS
UseCRISPR; In vitro transcription; t7 promoterTagsBPNLSExpressionMammalianMutationPhi29(-exo;D169A)PromoterCMV and T7Available SinceNov. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
pUC-GFP-MCC
Plasmid#133307Purpose"Burdensome" GFP expressing plasmid carrying microcin-V bacteriocin for plasmid stabilisationDepositorInsertmicrocin-V bacteriocin cassette (cvaC E. coli)
UseSynthetic BiologyExpressionBacterialMutationN112D (please see depositors comments)Available SinceFeb. 20, 2020AvailabilityAcademic Institutions and Nonprofits only -
pEMS1994
Plasmid#49124PurposeAAV plasmid with S100B (Ple266) promoter driving expression of iCre.DepositorInsertssAAV-Ple266-iCre
UseAAVExpressionMammalianPromoterS100BAvailable SinceMay 6, 2014AvailabilityIndustry, Academic Institutions, and Nonprofits -
pY109 (lenti-LbCpf1)
Plasmid#84740PurposeLenti virus delivery of LbCpf1 and crRNA guideDepositorInsertshuLbCpf1
puromycin resistance gene
UseLentiviralTags3xHA, NLS, and P2APromoterEFSAvailable SinceNov. 14, 2016AvailabilityAcademic Institutions and Nonprofits only -
pcS-RDG-C1C2
Plasmid#200163PurposeThis plasmid encodes non-binder control monobody (RDG) fused to the extracellular vesicle binding domain (C1C2) of lactadherin for surface engineering extracellular vesicles.DepositorInsertsRDG-C1C2
C1C2 domain of lactadherin
TagsHA and HISExpressionMammalianMutationsequence adopted from doi: 10.1371/journal.pone.0…Available SinceSept. 29, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLPC-LaminA
Plasmid#69059Purposeencodes the LaminA-CS proteinDepositorAvailable SinceDec. 15, 2015AvailabilityAcademic Institutions and Nonprofits only -
pRK5-FLAG-FNIP2
Plasmid#72294PurposeoverexpressionDepositorAvailable SinceFeb. 2, 2016AvailabilityAcademic Institutions and Nonprofits only -
HyperADAR control
Plasmid#166969PurposeExpress the Hyperactive catalytic domain of Drosophila ADAR and linker at the 5' end of this domain, in the MSCV-IRES-GFPDepositorInsertlinker-hyperADAR
UseRetroviralTagslinker-HyperADARExpressionMammalianPromoterMSCVAvailable SinceMarch 17, 2021AvailabilityAcademic Institutions and Nonprofits only -
pRN3P_T3_ABE8e_IVT
Plasmid#201676PurposePlasmid to be used as DNA template for in vitro RNA transcription of the ABE8e base editor (A to G) by T3 RNA polymerase. The plasmid contains optimised 5'UTR and 3'UTR to improve protein expression.DepositorInsertecTadA(8e)-nSpCas9
UseCRISPR; Vector for in-vitro transcriptionPromoterT3 promoterAvailable SinceApril 4, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-GFP-IRES-mSNCA
Plasmid#185714PurposeAAV expression of GFP and mouse α-Synuclein from hSyn promoterDepositorAvailable SinceJune 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAS_4xMx PylT_FLAG-Mx PylRS
Plasmid#140011PurposePlasmid with 4xMx PylT cassette and MX1201 PylRS for amber suppression; for transient or stable piggyBac-mediated integrationDepositorInsertMx1201 PylRS (MMALV_RS05520 Methanomethylophilus alvus Mx1201)
TagsFLAGExpressionMammalianPromoterEF1Available SinceMay 11, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Ef1a-sRGECO
Plasmid#137125PurposeViral expression of sRGECODepositorHas ServiceAAV8InsertsRGECO
UseAAVMutationE217DPromoterEF1aAvailable SinceJune 25, 2020AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-GFP11(x7)-Actin
Plasmid#181967PurposeHuman beta actin tagged with 7 copies of GFP11.DepositorInsertGFP11(x7)-Actin (ACTB )
Tags6xHIS - T7 tag (gene 10 leader) - Xpress (TM) tag…ExpressionMammalianPromoterCMVAvailable SinceJune 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
8xNFAT-ZsG-hCD4
Plasmid#162746PurposeNFAT-driven ZsGreen-1 reporter gene with human CD4 geneDepositorInsert8x of NFAT binding motif follwed by ZsGreen-1 fluorescent protein gene (CD4 Human)
UseRetroviralExpressionMammalianAvailable SinceJan. 7, 2021AvailabilityAcademic Institutions and Nonprofits only -
-
pPB-EF1A-Puro-hTBK1-E696K-EGFP
Plasmid#221554PurposeExpresses GFP-tagged human TBK1 with E696K mutation in mammalian cells. Compatible with piggybac transposase for genome integration.DepositorInsertTBK1 (TBK1 Human)
UsePiggybacTagsGFPExpressionMammalianMutationChanged glutamate 696 to lysinePromoterEF1aAvailable SinceJuly 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pET-alpha-synuclein-BiFC
Plasmid#87855PurposepETDUET-1 based vector for BiMolecular Fluorescence Complementation based assays of alpha-synuclein oligomerisationDepositorInsertsalpha-synuclein-VC155
alpha-synuclein-VN154
TagsC-terminal fragment of mVenus BiFC protein and N-…ExpressionBacterialPromoterT7Available SinceApril 3, 2017AvailabilityAcademic Institutions and Nonprofits only