We narrowed to 6,203 results for: 338
-
Plasmid#171800PurposeUniversal donor plasmid for CRISPitope method encoding mNeon fluorescent protein and puromycin resistance cassette [p.M1G]DepositorInsertmNeonGreen-T2A-PuroR
UseGene taggingMutationPuroR: Changed Methionin 1 to Glycine.Available SinceSept. 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCRISPaint-mScarlet-PuroR [M1G]
Plasmid#171809PurposeUniversal donor plasmid for CRISPitope method encoding mScarlet fluorescent protein and puromycin resistance cassette [p.M1G]DepositorInsertmScarlet-T2A-PuroR
UseGene taggingMutationPuroR: Changed Methionin 1 to Glycine.Available SinceJuly 20, 2021AvailabilityAcademic Institutions and Nonprofits only -
pDGB3 alpha1 Tnos:nptII:Pnos - P35S:Cas9:Tnos - P35S:DsRed:Tnos (GB2234)
Plasmid#160628PurposeModule for the constitutive expression of the nptII, Cas9 and DsRed genes.DepositorInserttNos:nptII:PNos-P35s:Cas9:tNos-P35s:DsRed:tNos
UseCRISPRMutationBsaI and BsmBI sites removedPromoterPnos, 35S, 35SAvailable SinceMarch 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
pRSET-RCaMP1h
Plasmid#42874Purposea single-wavelength red-shifted genetically encoded calcium indicator constructed from calmodulin and cp-mRubyDepositorInsertRed Fluorescent Calcium binding Protein
TagsEK (Enterokinase) Recognition Site, His Tag (6x),…ExpressionBacterialPromoterT7Available SinceFeb. 22, 2013AvailabilityAcademic Institutions and Nonprofits only -
pJEP321-pAAV-FullU6TO-SaCas9gRNAi(SapI)-CMV-TetR-P2A-GFP-KASH-WPRE-shortPA Empty Cassette
Plasmid#113698PurposeDox-inducible U6 SaCas9 gRNA expression cassette without a gRNA. Followed by an EFS driven GFP-KASH in a separate reading frame. SapI can be used to clone in gRNAs.DepositorInsertsSaCas9 gRNA Cassete
GFP
UseAAV and CRISPRTagsKASHAvailable SinceFeb. 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
pDONR223-NTRK3
Plasmid#23901DepositorInsertNTRK3 (NTRK3 Human)
UseGateway donor vectorMutationF441L and L653P relative to NM_001012338.3Available SinceJuly 30, 2010AvailabilityAcademic Institutions and Nonprofits only -
CL20_mEGFP_TCF3_HLF
Plasmid#205935PurposeExpress mEGFP-tagged fusion protein, TCF3_HLF from patient-derived sequenceDepositorAvailable SinceNov. 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCMV-T7-ABE8e-SpCas9-NRCH-P2A-EGFP (RMD57)
Plasmid#197504PurposeCMV and T7 promoter expression plasmid for human codon optimized ABE8e A-to-G base editor with nSpCas9-NRCH(D10A) and P2A-EGFPDepositorInsertpCMV-T7-ABE8e-NRCH-P2A-EGFP
UseCRISPR; In vitro transcription; t7 promoterTagsBPNLS and BPNLS-P2A-EGFPExpressionMammalianMutationABE8e mutations in TadA and nSpCas9-NRCH(D10A/I32…PromoterCMV and T7Available SinceMarch 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCRISPaint-mScarlet-BlastR [M1G]
Plasmid#171814PurposeUniversal donor plasmid for CRISPitope method encoding mScarlet fluorescent protein and blasticidin resistance cassette [p.M1G]DepositorInsertmScarlet-T2A-BlastR
UseGene taggingMutationBlastR: Changed Methionin 1 to Glycine.Available SinceJuly 21, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCRISPaint-mNeon-BlastR [M1G]
Plasmid#171805PurposeUniversal donor plasmid for CRISPitope method encoding mNeon fluorescent protein and blasticidin resistance cassette [p.M1G]DepositorInsertmNeonGreen-T2A-BlastR
UseGene taggingMutationBlastR: Changed Methionin 1 to Glycine.Available SinceJuly 20, 2021AvailabilityAcademic Institutions and Nonprofits only -
pVD1 Multiplexing Dicot Edit E1_NTERM (GB2245)
Plasmid#160567PurposetRNA and scaffold for the assembly of GBoligomers for position [D1_n] of a monocistronic tRNA-gRNADepositorInsertMultiplexing Dicot Edit E1_NTERM (Multiplexing Dicot Edit)
UseCRISPR and Synthetic BiologyMutationBsaI and BsmBI sites removedAvailable SinceMarch 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLgw ELK4-V5-EcoDam
Plasmid#98607PurposeMammalian DamID lentiviral vector for ELK4 with Dam-V5 using Gateway cloningDepositorInsertELK4 (Elk4 Mouse)
UseLentiviral; DamidTagsV5 and Dam (DNA adenine methyltransferase)ExpressionMammalianPromoterHeat Shock Minimal PromoterAvailable SinceJuly 28, 2017AvailabilityAcademic Institutions and Nonprofits only -
pJEP315-pAAV-U6SaCas9gRNA(CREB)-CMV-SaCas9-DIO-pA
Plasmid#113692PurposeU6 SaCas9 gRNA expression cassette containing a gRNA targeting the CREB gene, followed by a CMV driven inverted SaCas9. SaCas9 is floxed to render the system cre-dependent.DepositorUseAAV, CRISPR, Cre/Lox, and Mouse TargetingTagsNLSPromoterCytomegalo Virus(CMV)Available SinceDec. 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
pJEP323-pAAV-FullH1TO-SaCa9gRNAi(SapI)-CMV-TetR-2A-EGFP-KASH-WPRE-shortPA Empty Cassette
Plasmid#113700PurposeDox-inducible H1 driven SaCas9 gRNA expression cassette without a gRNA. Followed by an EFS driven GFP-KASH in a separate reading frame. SapI can be used to clone in a gRNAs.DepositorInsertsSaCas9 gRNA Cassete
GFP
UseAAV and CRISPRTagsKASHAvailable SinceDec. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pSpdCas9-hudTET1CD-T2A-mCherry(PX458)-SghuTSDR-8
Plasmid#129048Purposeinactivated control (targeted DNA demethylation_human_TSDR), expression of dCas9-hudTET1CD-T2A-mCherry sgRNA8 targeting human TSDRDepositorInsertdCas9-hudTET1CD, SgRNA8 (huTSDR)
TagsHA-Tag, NLS and T2A-mCherryExpressionMammalianMutationdCas9 (D10A;H840A), catalytic domain huTET1 inact…PromoterCbH (for dCas9-hudTET1CD-T2A-EGFP) U6 (for sgRNA)Available SinceJan. 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
pSpdCas9-hudTET1CD-T2A-mCherry(PX458)-SghuTSDR-1
Plasmid#129041Purposeinactivated control (targeted DNA demethylation_human_TSDR), expression of dCas9-hudTET1CD-T2A-mCherry sgRNA1 targeting human TSDRDepositorInsertdCas9-hudTET1CD, SgRNA1 (huTSDR)
TagsHA-Tag, NLS and T2A-mCherryExpressionMammalianMutationdCas9 (D10A;H840A), catalytic domain huTET1 inact…PromoterCbH (for dCas9-hudTET1CD-T2A-EGFP) U6 (for sgRNA)Available SinceJan. 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
pDGB3 omega1 Tnos:nptII:Pnos - P35S:Cas9:Tnos - P35S:DsRed:Tnos (GB2235)
Plasmid#160646PurposeModule for the constitutive expression of the nptII, Cas9 and DsRed genes.DepositorInserttNos:nptII:PNos-P35s:Cas9:tNos-P35s:DsRed:tNos
UseCRISPRMutationBsaI and BsmBI sites removedPromoterPnos, 35S, 35SAvailable SinceJan. 11, 2021AvailabilityAcademic Institutions and Nonprofits only -
pVD1 tRNA-gRNA position E3 (GB2240)
Plasmid#160562PurposetRNA and scaffold for the assembly of GBoligomers for the third position (positon [D3_4]) of a polycistronic tRNA-gRNA regulated by the U6-26 or U6-1 promoterDepositorInserttRNA-gRNA position E3 (Multiplexing Edit)
UseCRISPR and Synthetic BiologyMutationBsaI and BsmBI sites removedAvailable SinceMarch 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
pDONR223-SH3BP5L
Plasmid#23566DepositorInsertSH3BP5L (SH3BP5L Human)
UseGateway donor vectorAvailable SinceJuly 30, 2010AvailabilityAcademic Institutions and Nonprofits only -
MB 94C thsS(t3)R-Bxb1_P7-sfGFP_mCherry
Plasmid#232471PurposeOptimized thiosulfate sensor with recombinase switch and fluorescent reporter (GFP), constitutive mCherryDepositorInsertsthsS(t3)
thsR
PphsA342
sfGFP
AxeTxe
mCherry
Bxb1 integrase
TagsssrA degradation tagExpressionBacterialMutationContains the following mutations K286Q, Q350H, I…PromoterJ23100 (TTGACGGCTAGCTCAGTCCTAGGTACAGTGCTAGC), J23…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only