We narrowed to 23,593 results for: promoter
-
Plasmid#48747PurposeExpression of luciferase driven by mPer2 promoter fragment containing E-box2 (bases -112 to +98 with respect to transcription start site at +1)DepositorInsertmPer2 promoter/enhancer region containing E-box2 (-112 to +98)
UseLuciferaseAvailable SinceDec. 5, 2013AvailabilityAcademic Institutions and Nonprofits only -
pKrox24(MapErk)Luc
Plasmid#200112PurposeLuciferase reporter for in cell monitoring of receptor tyrosine kinase-MAP ERK pathway activityDepositorInsertMapErk sequence in minimal promoter
ExpressionMammalianMutationhighly modified sequencePromoter5 copies of designed MapErk sequence in minimal p…Available SinceJune 29, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSLPB2B-FKBP12_F36V-CasRx-tagBFP-PGK-Blasticidin
Plasmid#187952PurposeFKBP12 (F36V mutant) degron-tagged CasRx fused with tagBFP, expressed under EF1-alpha promoter in a piggyBac plasmid. Expresses Blasticidin resistance under PGK promoter.DepositorInsertFKBP12_F36V-CasRx-tagBFP
UseCRISPR and Synthetic BiologyTagsGGS linker, HA-tag, and NLSExpressionMammalianAvailable SinceOct. 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
pHes7-Achilles-Hes7
Plasmid#153528PurposeExpresses fusion protein of Achilles/YFP and mouse Hes7 from mouse Hes7 promoter. The reporter shows oscillatory expression with 2-3 periodicity when expressed in mouse presomitic mesoderm.DepositorAvailable SinceJuly 22, 2020AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-HA2-DDB1
Plasmid#19909DepositorInsertDamage-specific DNA binding protein 1 (DDB1 Human)
TagsHAExpressionMammalianMutationplease see depositor comment belowAvailable SinceApril 1, 2009AvailabilityAcademic Institutions and Nonprofits only -
pLEX303-GFP
Plasmid#162032PurposeTagged vector controlDepositorTypeEmpty backboneUseLentiviralTagsGFPAvailable SinceDec. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCAGIG_V5-PPP6C
Plasmid#92013PurposeExpresses V5-PPP6C, includes IRES-EmeraldDepositorAvailable SinceAug. 25, 2017AvailabilityAcademic Institutions and Nonprofits only -
pBLADE(FP6**)-mCherry
Plasmid#168049PurposeExpresses the synthetic gene BLADE FP6 under the constitutive J23101** promoter. mCherry expression is controlled by the PBAD promoter.DepositorInsertsBlue light-inducible AraC dimers in Escherichia coli
mCherry
ExpressionBacterialPromoterJ23101** and PBADAvailable SinceMay 11, 2021AvailabilityAcademic Institutions and Nonprofits only -
pKrox24(MapErk)dTomato
Plasmid#200113PurposeFluorescent reporter for in cell monitoring of receptor tyrosine kinase-MAP ERK pathway activityDepositorInsertMapErk sequence in minimal promoter
ExpressionMammalianMutationhighly modified sequencePromoter5 copies of designed MapErk sequence, no other pr…Available SinceMay 23, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSBbi G418 Hu Her2
Plasmid#183246PurposeExpression of human HER2 antigen in a Sleeping Beauty transposon vectorDepositorInsertHer2 (ERBB2 Human)
ExpressionMammalianAvailable SinceOct. 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
pKrox24(2xD-E)dTomato
Plasmid#200110PurposeFluorescent reporter for in cell monitoring of receptor tyrosine kinase-MAP ERK pathway activityDepositorInsertmodified EGR1 promoter
ExpressionMammalianMutationhighly modified sequencePromoter2 copies of D-E element, no other promoter elemen…Available SinceJune 29, 2023AvailabilityAcademic Institutions and Nonprofits only -
413 pSG5L HA RB
Plasmid#10720DepositorAvailable SinceNov. 2, 2005AvailabilityAcademic Institutions and Nonprofits only -
pLX317 GFP
Plasmid#193681PurposeConstitutive lentiviral expression of GFPDepositorInsertGFP
UseLentiviralAvailable SinceDec. 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
pN565
Plasmid#49990Purposeexpresses an attenuated T7 RNAP under an isopropyl β-d-1-thiogalactopyranoside (IPTG) inducible controlDepositorInsertT7 RNAP*
UseSynthetic BiologyTagsumuD degradation tagExpressionBacterialMutationR632SPromoterpTac-symmetricAvailable SinceJan. 31, 2014AvailabilityAcademic Institutions and Nonprofits only -
pBeta-lacZ-attBx2
Plasmid#124445PurposePlasmid for in vivo enhancer reporter assay. Plasmid contains a β-globin minimal promoter followed by a lacZ reporter gene derived from pRS16, with the entire reporter cassette flanked by attB sites.DepositorTypeEmpty backboneUseEnhancer reporter assay constructTagsLacZExpressionMammalianPromoterbeta globin minimal promoterAvailable SinceMay 2, 2019AvailabilityAcademic Institutions and Nonprofits only -
pGWB404
Plasmid#74798PurposeGateway cloning compatible binary vector for C-terminal fusion with sGFP (no promoter).DepositorTypeEmpty backboneExpressionPlantPromoterNo PromoterAvailable SinceJuly 18, 2016AvailabilityAcademic Institutions and Nonprofits only -
pKRG3-mU6-PUb-hSpCas9-pAc
Plasmid#162163PurposeExpresses hSpCas9-T2A-pAc (Ae. aegypti PUb promoter) with cloning site for sgRNAs (Ae. aegypti U6 promoter); puromycin selectableDepositorInsertshSpCas9
sgRNA
UseCRISPRTagsT2A-pAcExpressionInsectPromoterAe. aegypti PUb and Ae. aegypti U6Available SinceJan. 15, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLX317 PRDM14
Plasmid#193682PurposeConstitutive lentiviral expression of PRDM14DepositorInsertPRDM14 (PRDM14 Human)
UseLentiviralAvailable SinceDec. 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
vDip-C: pAAV-Pcp2-mGreenLantern-KASH
Plasmid#207613PurposevDip-C AAV vector with mouse Pcp2 (also known as L7) promoter driving green fluorophore mGreenLantern with a KASH nuclear membrane tag to isolate cell nuclei of cerebellar Purkinje cellsDepositorInsertmGreenLantern
UseAAVTagsKASHPromotermouse Pcp2 promoter (L7-6)Available SinceOct. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAP05
Plasmid#186261PurposesfGFP under light light responsive PEL222 promoter and EL222 under constitutively active BBa_J2305 promoterDepositorInsertsExpressionBacterialPromoterBBa_23105 (GGCTAGCTCAGTCCTAGGTACTATGCTAGC) and PE…Available SinceSept. 15, 2022AvailabilityAcademic Institutions and Nonprofits only