We narrowed to 872 results for: Anti-CRISPR
-
Plasmid#194508PurposeCRISPR/Cas9-mediated generic protein taggingDepositorInsertcLAP(EGFP)-P2A-NGFR
UseBacterial cloning vectorAvailable SinceFeb. 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
pGTag NGFR EGFP nLAP +1
Plasmid#194315PurposeCRISPR/Cas9-mediated generic protein taggingDepositorInsertNGFR-P2A-nLAP(EGFP)
UseBacterial cloning vectorAvailable SinceFeb. 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
pGTag NGFR EGFP nLAP +0
Plasmid#194314PurposeCRISPR/Cas9-mediated generic protein taggingDepositorInsertNGFR-P2A-nLAP(EGFP)
UseBacterial cloning vectorAvailable SinceFeb. 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
PCR4-Hsp68::mCherry-SI-Hsp68::eGFP-H11
Plasmid#211942Purposedual-enSERT-2.2 vector for site-specific integration of.a two-color enhancer-reporter construct into the H11 locus (separated by a synthetic insulator)DepositorTypeEmpty backboneUseCRISPR and Mouse TargetingExpressionMammalianPromoterHSP68Available SinceMarch 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pUC57-GFP-SFPQ-RT
Plasmid#97090PurposeEncodes a HR repair template for knock-in of an EGFP insert that fused to the 5'-end of human SFPQ gene, without disturbing its promoter. Best used with px330-GFP-SFPQ vector.DepositorInsertEGFP-SFPQ-RT (SFPQ Human)
UseCRISPRAvailable SinceJuly 31, 2017AvailabilityAcademic Institutions and Nonprofits only -
pYFP-NEAT1pr_v2-RT
Plasmid#97088PurposeEncodes a HR repair template for knock-in a YFP expression cassette at the promoter of human NEAT1 gene. Best used with px330-NEAT1pr_v2 vector, but also works with px330-NEAT1pr_v1.DepositorAvailable SinceJuly 31, 2017AvailabilityAcademic Institutions and Nonprofits only -
pYFP-NEAT1m_v1-RT
Plasmid#97089PurposeEncodes a HR repair template for knock-in a YFP expression cassette downstream of the poly(A) signal of human NEAT1_1 isoform. Best used with px330-NEAT1m_v1 vector.DepositorAvailable SinceJuly 31, 2017AvailabilityAcademic Institutions and Nonprofits only -
pYFP-NEAT1_IS_RT
Plasmid#97091PurposeEncodes a HR repair template that mutates the poly(A) signal as well as a few splicing factor binding sites of human NEAT1_1 isoform. Best used with px335-NEAT1_IS_v1 and v2 vectors.DepositorAvailable SinceJuly 31, 2017AvailabilityAcademic Institutions and Nonprofits only -
px552-sg-gria1-HT-SEP
Plasmid#187653PurposeContains HaloTag-SEP to be inserted into the NTD of Gria1 (via HITI) and single guide RNA to target Cas9 to Gria1 under control of the U6 promoter.DepositorInsertHaloTag-SEP donor
UseAAV and CRISPRTagsN/APromoterN/AAvailable SinceOct. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCW-tTRE-scFv-SunTag
Plasmid#193138PurposeExpresses scFv intracellular antibody component of the SunTag system under Dox regulationDepositorInsertscFv-SunTag
UseLentiviralExpressionMammalianPromotertight TRE promoterAvailable SinceNov. 10, 2022AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgCdkn2a/Cre
Plasmid#89644PurposeExpresses a Cdkn2a-targeting gRNA and Cre-recombinaseDepositorAvailable SinceJuly 19, 2017AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgKeap1/Cre
Plasmid#89645PurposeExpresses a Keap1-targeting gRNA and Cre-recombinaseDepositorAvailable SinceJuly 19, 2017AvailabilityAcademic Institutions and Nonprofits only -
GS2.1/EC
Plasmid#132568PurposesgRNA targeting A. thaliana pds3, regulated by A. thaliana U6 polIII promoter. Cas9 with a C-terminal mApple fusion, egg cell-specific expression. Hygromycin selectable marker (hpt).DepositorInsertegg cell promoter, Cas9-mApple, pds3 sgRNA
UseCRISPR and Synthetic BiologyExpressionPlantPromoterA. thaliana egg cell promoterAvailable SinceDec. 10, 2019AvailabilityAcademic Institutions and Nonprofits only -
pGGD-ZmUBI Promoter-scFV-sfGFP
Plasmid#246802PurposeA GreenGate entry vector containing scFV-sfGFP fusion gene drived by an ZmUBI PromoterDepositorInsertZmUBI Promoter-scFV-sfGFP
UseGreengate cloning entry vectorAvailable SinceJan. 2, 2026AvailabilityAcademic Institutions and Nonprofits only -
EHMT1_exon 3_gRNA
Plasmid#228809PurposeCRISPR targeting of human EHMT1DepositorAvailable SinceMarch 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pSLiP-G1
Plasmid#188963PurposeL-Rhamnose inducible catalytically inactive Cas9 with sgRNA for bacterial gene knockdownDepositorInsertsdCas9
sgRNA: atcggtcgcattgttttccactagg
UseSynthetic BiologyExpressionBacterialPromoterPrhaBADAvailable SinceSept. 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSLiP-G2
Plasmid#188964PurposeL-Rhamnose inducible catalytically inactive Cas9 with sgRNA for bacterial gene knockdownDepositorInsertsdCas9
sgRNA: gttagacgctgattacatggactagg
UseSynthetic BiologyExpressionBacterialPromoterPrhaBADAvailable SinceSept. 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDY118A
Plasmid#182958PurposepSC101 ori, chl34 resistant. Cas9 induced at 0.4 μg/ml anhydrotetracycline, recombineering proteins induced by a 15 min heat-shock at 42°C, I-Scel (induced by 0.1 mM IPTG) is to cleave the pDonor2.DepositorInsertsCas9
Gam, Beta, Exo
I-scel
Available SinceJan. 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSMART Tmem192-3X HA (targeting vector for genomic tagging)
Plasmid#175777PurposepSMART Tmem192-3X HA (targeting vector for genomic tagging)DepositorInsertTMEM192 (TMEM192 Human)
UseCRISPRAvailable SinceFeb. 24, 2022AvailabilityAcademic Institutions and Nonprofits only -
pMBP-HRV3C-AcrIF9
Plasmid#141442PurposeExpression of AcrIF9 in E. coli, tagged with an HRV3C-cleavage fusion to Maltose Binding Protein.DepositorInsertAcrIF9
TagsHRV3C cleavage site and Maltose Binding ProteinExpressionBacterialPromoterptacAvailable SinceMay 26, 2021AvailabilityAcademic Institutions and Nonprofits only