We narrowed to 13,810 results for: OVA
-
Plasmid#208799PurposeXenopus laevis His6-Myc-DONSON (D374A, E377A, W381A, S437A)DepositorInsertDONSON (donson.L Frog)
TagsHis and MycExpressionBacterialMutationD374A; E377A; W381A; S437APromoterT7Available SinceFeb. 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
pET28a-DONSON-3A
Plasmid#208800PurposeXenopus laevis His6-Myc-DONSON (V473A, R476A, Y481A)DepositorInsertDONSON (donson.L Frog)
TagsHis and MycExpressionBacterialMutationV473A; R476A; Y481APromoterT7Available SinceFeb. 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
pET28a-DONSON-Δ24
Plasmid#208801PurposeXenopus laevis His6-Myc-DONSON (1-24aa removed)DepositorInsertDONSON (donson.L Frog)
TagsHis and MycExpressionBacterialMutationΔ24, deletion of 1-24aaPromoterT7Available SinceFeb. 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
pET28a-DONSON-DEW
Plasmid#208802PurposeXenopus laevis His6-Myc-DONSON (D374A, E377A, W381A)DepositorInsertDONSON (donson.L Frog)
TagsHis and MycExpressionBacterialMutationD374A; E377A; W381APromoterT7Available SinceFeb. 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
pEJS1983 Lenti-dead_GFP_ABE reporter-BlastR
Plasmid#211820PurposeLentiviral vector expressing a dead GFP adenine base editing reporterDepositorInsertdead GFP reporter
UseLentiviralExpressionMammalianPromoterCMV promoter and SV40 promoterAvailable SinceJan. 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
pEJS-HZ08-pAAVsc.U6-tracrRNA
Plasmid#211816PurposeAAV vector expressing tracrRNA under U6 promoterDepositorInsertU6-tracrRNA
UseAAVExpressionMammalianPromoterU6Available SinceJan. 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
Qt-FLAG-TGA-rt9us-antiGFP
Plasmid#206954PurposeMammalian expression of Qt EMcapsulins targeting GFP with stoichiometry control (~8% surface decoration)DepositorInsertQtEnc, antiGFP-intrabody
ExpressionMammalianAvailable SinceJan. 2, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLINE1mORF1-ΔORF2-scFvFc
Plasmid#206023PurposeThe base next to the ORF1 start codon (ATG) was deleted in pLINE1ΔORF2-scFvFcDepositorInsertmouse LINE1 vector harboring an scFv-Fc expression unit, encoding mutated ORF1 but lacking ORF2
ExpressionMammalianAvailable SinceDec. 18, 2023AvailabilityAcademic Institutions and Nonprofits only -
pETDUET-GST AO7RE ∆238-245
Plasmid#139318PurposeGST tagged AO7 encoding aa 126-258 with an internal deletion that results in loss of E2 binding for expression in bacteriaDepositorInsertAO7 aa 126-258 (RNF25 Human)
TagsGSTExpressionBacterialMutationAO7 cloned into the first multiple cloning site o…PromoterT7 promoter-1Available SinceDec. 15, 2023AvailabilityAcademic Institutions and Nonprofits only -
pGEMHE-MmCENP-O-GFP
Plasmid#205178PurposeExpresses mouse CENP-O C-term tagged with GFP under T7 promoter - designed for in vitro transcriptionDepositorInsertCENP-O (Cenpo Mouse)
UseIn vitro transcriptionTags5 glycines linker followed by GFPExpressionMammalianMutationWild type mouse CENP-OPromoterT7Available SinceOct. 19, 2023AvailabilityAcademic Institutions and Nonprofits only -
Qt-FLAG-TAA-rt20s-antiGFP
Plasmid#206955PurposeMammalian expression of Qt EMcapsulins targeting GFP with stoichiometry control (~6% surface decoration)DepositorInsertQtEnc, antiGFP-intrabody
ExpressionMammalianAvailable SinceSept. 29, 2023AvailabilityAcademic Institutions and Nonprofits only -
1M-Qt-FLAG-TGA-rt20s-antiGFP
Plasmid#206953PurposeMammalian expression of 1M-Qt EMcapsulins targeting GFP with stoichiometry control (~20% surface decoration)DepositorInsertMmMT3, QtEnc, antiGFP-intrabody
ExpressionMammalianAvailable SinceSept. 29, 2023AvailabilityAcademic Institutions and Nonprofits only -
pGL4.23-Gja1prom
Plasmid#188114PurposeExpresses luciferase under control of Gja1 promoter in transfected cellsDepositorInsertGja1 promoter (Gja1 Mouse)
UseLuciferasePromoterGja1 endogenous promoter up to gene start codonAvailable SinceSept. 28, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAG426GAL-CV-B3_3C
Plasmid#203499PurposeExpresses CV-B3 3C protease from a GAL promoter with a URA3 markerDepositorAvailable SinceAug. 14, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAG426GAL-LV_3CL
Plasmid#203507PurposeExpresses LV 3CL protease from a GAL promoter with a URA3 markerDepositorInsertLV 3CL protease
ExpressionYeastPromoterGAL1Available SinceAug. 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAG416GAL10-SHV_3CL
Plasmid#203473PurposeExpresses SHV 3CL protease from a GAL10 promoter with a URA3 markerDepositorInsertSHV 3CL protease
ExpressionYeastPromoterGAL10Available SinceAug. 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAG426GAL-HHV-3_PR
Plasmid#203505PurposeExpresses protease domain of HHV-3 (VZV) from a GAL promoter with a URA3 markerDepositorInsertHHV-3 protease domain
ExpressionYeastPromoterGAL1Available SinceJuly 31, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAG416GAL10-NWV_3CL
Plasmid#203470PurposeExpresses NWV 3CL protease from a GAL10 promoter with a URA3 markerDepositorInsertNWV 3CL protease
ExpressionYeastPromoterGAL10Available SinceJuly 31, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAG416GAL10-HTLV_PR
Plasmid#203467PurposeExpresses HTLV protease from a GAL10 promoter with a URA3 markerDepositorInsertHTLV protease
ExpressionYeastPromoterGAL10Available SinceJuly 31, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAG416GAL10-PV_3C
Plasmid#203472PurposeExpresses PV 3C protease from a GAL10 promoter with a URA3 markerDepositorAvailable SinceJuly 31, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAG416GAL10-SV-A_3C
Plasmid#203474PurposeExpresses SV-A 3C protease from a GAL10 promoter with a URA3 markerDepositorAvailable SinceJuly 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAG416GAL-1x-HIV-2_PR
Plasmid#201935PurposeExpresses HIV-2 protease from a GAL-1x promoter with a URA3 markerDepositorInsertHIV-2 protease
ExpressionYeastPromoterGAL1Available SinceJuly 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
pET-28a(+)-6xHis-TEV-ORF9c
Plasmid#201023PurposeBacterial expression of codon optimized SARS-CoV-2 ORF9c tagged with an N-terminus His tag followed by a TEV cleavage site.DepositorInsertopen reading frame 9c
Tags6xHis-TEVExpressionBacterialMutationGene insert is codon optimized for Ecoli.PromoterT7/LacOAvailable SinceJune 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
DNMT2Δ191-237
Plasmid#198382PurposeBacterial expression plasmid for human DNMT2 deletion mutant; for binding assaysDepositorInsertDNMT2 (TRDMT1 Human)
TagsHis-tagExpressionBacterialMutationdeleted amino acids 191-237PromoterT7Available SinceMay 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-U6-DR30(sapI)-CMV-intron-hfCas13d-pA
Plasmid#195865PurposeTo express hfCas13dDepositorInserthigh fidelity (hf) version of CasRx (hfCas13d)
UseAAVMutationYes: GTGGAATACATTACCAACGTGGTGTACGTGPromoterCMVAvailable SinceJan. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-intron-DIO-hfCas13d-pA
Plasmid#195866PurposeTo express hfCas13dDepositorInserthigh fidelity (hf) version of CasRx (hfCas13d)
UseAAVMutationYes: GTGGAATACATTACCAACGTGGTGTACGTGPromoterCMVAvailable SinceJan. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pX330A-Yap1-E1-#2
Plasmid#171519Purposedeletion of a genomic locus in Yap1 geneDepositorAvailable SinceNov. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
-
piwi_sgRNA
Plasmid#186653Purposepiwi sgRNA plasmidDepositorInsertPiwi sgRNA Plasmid (piwi Fly)
ExpressionInsectAvailable SinceAug. 10, 2022AvailabilityAcademic Institutions and Nonprofits only -
pIG-742pUC19-tNGFR-P2A-Caspase8
Plasmid#186099PurposeKnockin of truncated NGFR to target geneDepositorInsertCASPASE8
UseCRISPRMutationWT with tNGFR sequenceAvailable SinceJuly 28, 2022AvailabilityAcademic Institutions and Nonprofits only