We narrowed to 10,497 results for: ada
-
Plasmid#170122PurposeAAV vector carrying 2 copies of a guide RNA targeting the mouse PCSK9 mRNA, expressed from human and mouse U6 promotersDepositorInsertCircular 200,100 guide RNA (Pcsk9 Mouse)
UseAAVExpressionMammalianPromoterHuman U6 and mouse U6Available SinceFeb. 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-HA-RAPGEF2
Plasmid#110162PurposeExpression of human RAPGEF2 in mammalian cellsDepositorInsertRAPGEF2 (Rap guanine nucleotide exchange factor 2 (RAPGEF2 Human)
TagsHAExpressionMammalianPromoterCMVAvailable SinceMay 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pDisplay-GRAB_NTS1.0
Plasmid#208670PurposeExpresses the genetically-encoded fluorescent neurotensin (NTS) sensor GRAB_NTS1.0 in mammalian cellsDepositorInsertGPCR activation based neurotensin (NTS) sensor GRAB_NTS1.0
ExpressionMammalianPromoterCMVAvailable SinceOct. 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
pX330-PITCh-COX8A
Plasmid#227308PurposeExpresses SpCas9, the PITCh gRNA, and a sgRNA targeting the C-terminus of COX8A for knock-in.DepositorInsertsgRNA Targeting C-terminus of COX8A (COX8A Human)
UseCRISPRExpressionMammalianPromoterU67Available SinceNov. 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
pC1-oROS-HT-CaaX
Plasmid#216417PurposeTargeting of the chemigenetic, fluorescent peroxide sensor oROS-HT to the intracellular site of cell membranes.DepositorInsertoROS-HT-CaaX
ExpressionMammalianPromoterCMVAvailable SinceMay 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pEF1a mNeonGreen-3K-B1-10-IRES-mKate2-2A-PuroR
Plasmid#215377PurposeLentiviral expression of a cytosolic-localized split mNeonGreen variant that enables efficient complementation when the missing beta strand is present. mKate2 is present as a transduction control.DepositorInsertmNeonGreen-3K-1-10
ExpressionMammalianAvailable SinceAug. 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
W118-1_Flag-hIRAK1
Plasmid#180405Purposelentiviral transduction of human IRAK1 (with an N-terminal Flag tag) geneDepositorAvailable SinceNov. 2, 2022AvailabilityAcademic Institutions and Nonprofits only -
pX330-PITCh-ACTB
Plasmid#207748PurposeExpresses SpCas9, the PITCh gRNA, and a sgRNA targeting the N-terminus of ACTB for knock-in.DepositorAvailable SinceNov. 15, 2023AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5FRT/TO-Npl4-Strep-HA
Plasmid#113495PurposeExpression of human Npl4 with C-terminal strep-HA tagDepositorInsertNpl4 (NPLOC4 Human)
Tags2xstrep-HAExpressionMammalianMutationwildtype without stop codonPromoterCMVAvailable SinceAug. 15, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-GRAB_VIP1.0
Plasmid#208681PurposeExpresses the genetically-encoded fluorescent vasoactive intestinal peptide (VIP) sensor GRAB_VIP1.0 in neuronsDepositorInsertGPCR activation based vasoactive intestinal peptide (VIP) sensor GRAB_VIP1.0
UseAAVPromoterhSynAvailable SinceOct. 13, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EF1_-DIO-GRAB_NPY1.0
Plasmid#208677PurposeExpresses the genetically-encoded fluorescent neuropeptide Y (NPY) sensor GRAB_NPY1.0 in a cre-dependent mannerDepositorInsertGPCR activation based neuropeptide Y (NPY) sensor GRAB_NPY1.0
UseAAVPromoterEF1_Available SinceOct. 25, 2023AvailabilityAcademic Institutions and Nonprofits only -
BcLOV4 fusion tools screening plasmid #1
Plasmid#174511PurposeCloning plasmid for creating BcLOV4 optogenetic tool fusions. Expresses [BamHI]-BcLOV4-[EcoRI]-GGGSx2-mCherry-[XhoI]-STOP in a pcDNA3.1 backbone.DepositorInsert[BamHI]-BcLOV4-[EcoRI]-GGGSx2-mCherry-[XhoI]-STOP
TagsmCherryExpressionMammalianPromoterCMVAvailable SinceDec. 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
pKK-TEV-CyOFP1
Plasmid#105799PurposeExpression of your protein of interest in fusion with orange fluorescent protein at the C-terminus (cleavable by TEV) (PMID: 27240196). CyOFP1 is useful for multi-channel imaging.DepositorTypeEmpty backboneUseFlp-in competentTagsTEV-CyOFP1ExpressionMammalianAvailable SinceFeb. 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
pHR-SFFV- MOG-VHVL-M26-synNotch-Gal4VP64
Plasmid#247467PurposeExpresses a synNotch binding to myelin oligodendrocyte glycoproteinDepositorInsertsynNotch receptor using a scFvs binding MOG
UseLentiviralExpressionMammalianAvailable SinceNov. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5FRT/TO-Ufd1-Strep-HA
Plasmid#113474PurposeExpression of human Ufd1 with C-terminal strep-HA tagDepositorInsertUfd1 (UFD1 Human)
Tags2xstrep-HAExpressionMammalianMutationwildtype without stop codonPromoterCMVAvailable SinceAug. 14, 2018AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3 FLAG FBXO31
Plasmid#236429Purposetransient overexpression of FBXO31 in mammalian cellsDepositorAvailable SinceMay 28, 2025AvailabilityAcademic Institutions and Nonprofits only -
qTAG-N-Solo-mStayGold-CETN2
Plasmid#227292PurposeDonor template for mStayGold insertion into the N-terminus of the CETN2 locus. For centriole visualization. To be co-transfected with sgRNA plasmid px330-CETN2 (Addgene #227291)DepositorInsertCETN2 Homology Arms flanking a mStayGold Tag (CETN2 Human)
UseCRISPR; Donor templateExpressionMammalianPromoterPromoterlessAvailable SinceNov. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
SECURE miniABEmax-K20A/R21A (pJUL1774)
Plasmid#131312PurposeCMV promoter expression plasmid for bpNLS-TadA7.10(K20A/R21A)-32AA linker-hSpCas9n(D10A)-bpNLS-P2A-EGFP-NLS (miniABEmax with K20A/R21A mutations).DepositorInsertbpNLS-TadA7.10(K20A/R21A)-32AA linker-hSpCas9n(D10A)-bpNLS-P2A-EGFP-NLS
ExpressionMammalianPromoterCMVAvailable SinceSept. 20, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-TRC.mKO2_shGFP
Plasmid#110318PurposeControl (Target CAAGCTGACCCTGAAGTTCAT), silence GFP and express monomeric Kusabira-Orange2DepositorInsertGFP
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceAug. 13, 2018AvailabilityAcademic Institutions and Nonprofits only -
qTAG-C-Solo-mStayGold-VIM
Plasmid#227302PurposeDonor template for mStayGold insertion into the C-terminus of the VIM locus. For intermediate filament visualization. To be co-transfected with sgRNA plasmid px330-PITCh-VIM (Addgene #227301)DepositorInsertVIM Homology Arms flanking a mStayGold Tag (VIM Human)
UseCRISPR; Donor templateExpressionMammalianPromoterPromoterlessAvailable SinceNov. 12, 2024AvailabilityAcademic Institutions and Nonprofits only