We narrowed to 46,678 results for: cha;
-
Plasmid#165116Purposemammalian expression and localizationDepositorAvailable SinceMarch 2, 2021AvailabilityAcademic Institutions and Nonprofits only
-
Human_TFAM_NoMTS_L6_pET28a+
Plasmid#60012PurposeExpresses TFAM No MTS L6 mutant in bacterial cellsDepositorInsertHuman TFAM No MTS (TFAM Human)
Tags6xHisExpressionBacterialMutationMissing 1st 42 aas (Mitochondrial targeting seque…PromoterT7Available SinceOct. 21, 2014AvailabilityAcademic Institutions and Nonprofits only -
Nsp7-mCherry
Plasmid#165134Purposemammalian expression and localizationDepositorAvailable SinceMarch 2, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLV-SFFV-CALU-WPRE-UbC-Emerald
Plasmid#225951PurposeLentiviral vector plasmid expressing human calumenin (CALU) under the spleen focus-forming virus (SFFV) promoter and Emerald under the Ubiquitin C (UbC) promoterDepositorAvailable SinceJan. 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
PZac2.1 gfaABC1D-Cx43-GFP
Plasmid#176860PurposeExpresses Cx43 fused with GFP at the C-terminus in astrocytesDepositorAvailable SinceApril 11, 2023AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS1014a
Plasmid#87396PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1014a sequence TTATGTGCGTATTGCTTTCA in yeast chromosome 10.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS1014a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS106a
Plasmid#87382PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS106a sequence ATACGGTCAGGGTAGCGCCC in yeast chromosome 1.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS106a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
ORF3a-EGFP
Plasmid#165121Purposemammalian expression and localizationDepositorAvailable SinceFeb. 10, 2021AvailabilityAcademic Institutions and Nonprofits only -
Nsp13-mCherry
Plasmid#165136Purposemammalian expression and localizationDepositorAvailable SinceMarch 2, 2021AvailabilityAcademic Institutions and Nonprofits only -
AAV_NLS-SaCas9-NLS-VPR
Plasmid#68496PurposeAAV vector containing SaCas9 fused to VPRDepositorInsertSaCas9-VPR
UseAAV and CRISPRTagsVPRExpressionMammalianPromoterCMVAvailable SinceSept. 18, 2015AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-eGFP-ProteinC
Plasmid#242774PurposeAAV transfer plasmid expressing eGFP-ProteinC under a CAG promoter.DepositorInsertEGFP
UseAAVTagsProteinCPromoterCAGAvailable SinceSept. 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-eGFP-Tag100
Plasmid#242779PurposeAAV transfer plasmid expressing eGFP-Tag100 under a CAG promoter.DepositorInsertEGFP
UseAAVTagsTag100PromoterCAGAvailable SinceSept. 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-eGFP-SPOT
Plasmid#242777PurposeAAV transfer plasmid expressing eGFP-SPOT under a CAG promoter.DepositorInsertEGFP
UseAAVTagsSPOTPromoterCAGAvailable SinceSept. 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-eGFP-AU5
Plasmid#242765PurposeAAV transfer plasmid expressing eGFP-AU5 under a CAG promoter.DepositorInsertEGFP
UseAAVTagsAU5PromoterCAGAvailable SinceSept. 29, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-eGFP-E2
Plasmid#242766PurposeAAV transfer plasmid expressing eGFP-E2 under a CAG promoter.DepositorInsertEGFP
UseAAVTagsE2PromoterCAGAvailable SinceSept. 29, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-eGFP-ETAG
Plasmid#242767PurposeAAV transfer plasmid expressing eGFP-ETAG under a CAG promoter.DepositorInsertEGFP
UseAAVTagsETAGPromoterCAGAvailable SinceSept. 29, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-eGFP-MoonTag
Plasmid#242770PurposeAAV transfer plasmid expressing eGFP-MoonTag under a CAG promoter.DepositorInsertEGFP
UseAAVTagsMoonTagPromoterCAGAvailable SinceSept. 29, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-eGFP-NWS
Plasmid#242772PurposeAAV transfer plasmid expressing eGFP-NWS under a CAG promoter.DepositorInsertEGFP
UseAAVTagsNWSPromoterCAGAvailable SinceSept. 29, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-eGFP-OLLAS
Plasmid#242773PurposeAAV transfer plasmid expressing eGFP-OLLAS under a CAG promoter.DepositorInsertEGFP
UseAAVTagsOLLASPromoterCAGAvailable SinceSept. 29, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-eGFP-S1
Plasmid#242775PurposeAAV transfer plasmid expressing eGFP-S1 under a CAG promoter.DepositorInsertEGFP
UseAAVTagsS1PromoterCAGAvailable SinceSept. 29, 2025AvailabilityAcademic Institutions and Nonprofits only