We narrowed to 3,314 results for: GCT
-
Plasmid#53244Purposereporter plasmid containing 2 myc cDNA binding sitesDepositorInsertpMyc2ElbLuc (MYC Human)
UseTagsExpressionMutationTo prepare plasmids with one, two, three, and fou…PromoterAvailable sinceJuly 29, 2014AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1(+)-MC38-TCRA-30-picky_sticky
Plasmid#138983PurposeIVT template for the alpha subunit of the mouse TCR #30 that is reactive against MC38DepositorInsertTCRA (Tcra Mouse)
UseTagsExpressionMammalianMutationPromoterCMV and T7Available sinceNov. 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1(+)-MC38-TCRB-33-MC_hammer
Plasmid#138990PurposeIVT template for the beta subunit of the mouse TCR #33 that is reactive against MC38DepositorInsertTCRB (Tcrb Mouse)
UseTagsExpressionMammalianMutationPromoterCMV and T7Available sinceMarch 9, 2020AvailabilityAcademic Institutions and Nonprofits only -
CSNK1A1 H1.4 gRNA
Plasmid#90640Purpose3rd generation lentiviral gRNA plasmid targeting human CSNK1A1DepositorInsertCSNK1A1 (Guide Designation H1.4)
UseCRISPR and LentiviralTagsExpressionMutationPromoterU6Available sinceJuly 20, 2017AvailabilityAcademic Institutions and Nonprofits only -
CBX5 A2.5 gRNA
Plasmid#90571Purpose3rd generation lentiviral gRNA plasmid targeting human CBX5DepositorInsertCBX5 (Guide Designation A2.5)
UseCRISPR and LentiviralTagsExpressionMutationPromoterU6Available sinceJuly 21, 2017AvailabilityAcademic Institutions and Nonprofits only -
PX458_KLF9_1
Plasmid#86346PurposeEncodes gRNA for 3' target of human KLF9DepositorInsertgRNA against KLF9 (KLF9 Human)
UseCRISPRTagsExpressionMutationPromoterAvailable sinceJan. 27, 2017AvailabilityAcademic Institutions and Nonprofits only -
-
FZR1 D10.1 gRNA
Plasmid#90693Purpose3rd generation lentiviral gRNA plasmid targeting human FZR1DepositorInsertFZR1 (Guide Designation D10.1)
UseCRISPR and LentiviralTagsExpressionMutationPromoterU6Available sinceJuly 13, 2017AvailabilityAcademic Institutions and Nonprofits only -
HJURP E3.1 gRNA
Plasmid#90710Purpose3rd generation lentiviral gRNA plasmid targeting human HJURPDepositorInsertHJURP (Guide Designation E3.1)
UseCRISPR and LentiviralTagsExpressionMutationPromoterU6Available sinceJuly 18, 2017AvailabilityAcademic Institutions and Nonprofits only -
TOP2A G12.2 gRNA
Plasmid#90915Purpose3rd generation lentiviral gRNA plasmid targeting human TOP2ADepositorInsertTOP2A (Guide Designation G12.2)
UseCRISPR and LentiviralTagsExpressionMutationPromoterU6Available sinceJuly 19, 2017AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA2-d5-HT2BR
Plasmid#221828PurposePlasmid to express gRNA2 (aggcactcgtgctcgaatag) for editing at the end of Drosophila 5-HT2BR coding frameDepositorInsertd5-HT2BR gRNA2 (CG42796 Fly)
UseCRISPRTagsExpressionInsectMutationPromoterDrosophila U6 promoterAvailable sinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA1-for-dSERT
Plasmid#221830PurposePlasmid to express gRNA1 (cgaaatctgcgctctacttg) for editing at the beginning of Drosophila SERT coding frameDepositorInsertdSERT gRNA1 (SerT Fly)
UseCRISPRTagsExpressionInsectMutationPromoterDrosophila U6 promoterAvailable sinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pk335-CARGO-3mer-30kb-DSF
Plasmid#227486Purpose3-mer gRNA array targeting Sp dCas9/Cas9 to the Prdm8-Fgf5 locusDepositorInsertCARGO to 30kb Downstream Fgf5
UseCRISPRTagsExpressionMutationPromoterAvailable sinceMay 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pk335-CARGO-5mer-Fgf5Pro
Plasmid#227480Purpose5-mer gRNA array targeting Sp dCas9/Cas9 to the Prdm8-Fgf5 locusDepositorInsertCARGO to Fgf5 promoter
UseCRISPRTagsExpressionMutationPromoterAvailable sinceMay 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pk335-CARGO-4mer-PrPro
Plasmid#227455Purpose4-mer gRNA array targeting Sp dCas9/Cas9 to the Prdm8-Fgf5 locusDepositorInsertCARGO to Prdm8 promoter Upstream Prdm8
UseCRISPRTagsExpressionMutationPromoterAvailable sinceMay 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pDY2259 hNOLC1 atgRNA Paired Guide 1
Plasmid#220989PurposehNOLC1 atgRNADepositorInsertNOLC1 atgRNA (NOLC1 Human)
UseCRISPRTagsExpressionMutationPromoterAvailable sinceDec. 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
RhoC gRNA #1
Plasmid#198724PurposeCas9-mediated knockout of RhoC in mammalian cells #1DepositorInsertRhoC (Rhoc Mouse)
UseCRISPRTagsExpressionMammalianMutationPromoterU6Available sinceDec. 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
FgH1tUTG-sgRNA.Control-ZEB2_CRISPRd
Plasmid#216172PurposeExpress the gRNA targeting the control site in the human ZEB2 locus for the CRISPRd experimentDepositorInsertsgRNA- Control- ZEB2.locus
UseLentiviralTagsEGFPExpressionMutationPromoterAvailable sinceJuly 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
plentiCRISPR-v2 Puro SPNS1_sg1
Plasmid#218530PurposesgRNA targeting human SPNS1DepositorInsertSPNS1 (SPNS1 Human)
UseCRISPR and LentiviralTagsExpressionMutationPromoterAvailable sinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAf-CRISPR-ctfR1
Plasmid#207992PurposeCRISPR vector used with pAf-CRISPR-phoA (#207991) to delete both aflatoxin and cyclopiazonic acid gene clusters of Aspergillus flavusDepositorInsertctfR1
UseCRISPRTagsExpressionMutationPromoterAspergillus flavus U6Available sinceJan. 2, 2024AvailabilityAcademic Institutions and Nonprofits only