We narrowed to 16,477 results for: GRN
-
Plasmid#179078PurposeSp.Cas9 and gRNA yeast expression vector for HDR-based gRNA introduction. Selection = Kanamycin resistanceDepositorInsertS. pyogenes Cas9
UseCRISPR and Synthetic BiologyExpressionYeastAvailable SinceMay 5, 2022AvailabilityAcademic Institutions and Nonprofits only -
pBBK07 pCAS-Tyr-[gRNA: BsaI GFP dropout] (LEU2,AmpR)
Plasmid#178991PurposeSp.Cas9 and gRNA yeast expression vector for HDR-based gRNA introduction. Selection = LEU2DepositorInsertS. pyogenes Cas9
UseCRISPR and Synthetic BiologyExpressionYeastAvailable SinceMay 2, 2022AvailabilityAcademic Institutions and Nonprofits only -
pBBK03 pCAS-Tyr-[gRNA: BsaI GFP dropout] (HygR,AmpR)
Plasmid#178987PurposeSp.Cas9 and gRNA yeast expression vector for HDR-based gRNA introduction. Selection = Hygromycin resistanceDepositorInsertS. pyogenes Cas9
UseCRISPR and Synthetic BiologyExpressionYeastAvailable SinceMay 2, 2022AvailabilityAcademic Institutions and Nonprofits only -
pBBK04 pCAS-Tyr-[gRNA: BsaI GFP dropout] (SplitHygR,AmpR)
Plasmid#178988PurposeSp.Cas9 and gRNA yeast expression vector for Golden Gate pre-cloning of gRNA. Selection = SplitHygromycin resistanceDepositorInsertS. pyogenes Cas9
UseCRISPR and Synthetic BiologyExpressionYeastAvailable SinceMay 2, 2022AvailabilityAcademic Institutions and Nonprofits only -
pJEP13-AAV-H1/TO-L-sgRNA(Tet2)-CMV-TetR-P2A-eGFP-KASH-pA
Plasmid#82703PurposeAAV backbone with a full length H1/TO promoter driving expression of a sgRNA that targets exon 3 of the mouse Tet2 locus. TracrRNA compatible with SpCas9. gRNA transcription is doxycycline dependent.DepositorInsertH1/TO-L gRNA Expression Cassette Containing Tet2 gRNA
UseAAV and CRISPRTagsCMV promoter driving expression of TetR-P2A-GFP-K…ExpressionMammalianAvailable SinceDec. 20, 2016AvailabilityAcademic Institutions and Nonprofits only -
pJEP14-AAV-H1/TO-sgRNA(Empty)-CMV-TetR-P2A-eGFP-KASH-pA
Plasmid#82702PurposeAAV backbone with a minimal H1/TO promoter driving expression of a sgRNA. The gRNA can be inserted via Sapl. TracrRNA compatible with SpCas9. gRNA transcription is doxycycline dependent.DepositorInsertH1/TO Empty gRNA Expression Cassette
UseAAV and CRISPRTagsCMV promoter driving expression of TetR-P2A-GFP-K…ExpressionMammalianAvailable SinceDec. 20, 2016AvailabilityAcademic Institutions and Nonprofits only -
pBBK95 pCAS-Tyr-[gRNA: 2xBsaI+NotI cut sites] (HygR)
Plasmid#179079PurposeSp.Cas9 and gRNA yeast expression vector for HDR-based gRNA introduction. Selection = Hygromycin resistanceDepositorInsertS. pyogenes Cas9
UseCRISPR and Synthetic BiologyExpressionYeastAvailable SinceAug. 5, 2022AvailabilityAcademic Institutions and Nonprofits only -
pBBK01 pCAS-Tyr-[gRNA: BsaI GFP dropout] (KanR, AmpR)
Plasmid#178985PurposeSp.Cas9 and gRNA yeast expression vector for HDR-based gRNA introduction. Selection = Kanamycin resistanceDepositorInsertS. pyogenes Cas9
UseCRISPR and Synthetic BiologyExpressionYeastAvailable SinceMay 2, 2022AvailabilityAcademic Institutions and Nonprofits only -
pW193-lenti-sasgRNA-lacZ-pEF1s-NLS-mNeonGreen-P2A-BlastR
Plasmid#170814PurposeLentiviral vector to co-express a lacZ control sasgRNA with NLS-mNeonGreenDepositorInsertNLS-mNeonGreen-P2A-BlastR
UseLentiviralExpressionMammalianMutationNAAvailable SinceJune 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
pBBK05 pCAS-Tyr-[gRNA: BsaI GFP dropout] (NatR,AmpR)
Plasmid#178989PurposeSp.Cas9 and gRNA yeast expression vector for HDR-based gRNA introduction. Selection = Nourseothricin resistanceDepositorInsertS. pyogenes Cas9
UseCRISPR and Synthetic BiologyExpressionYeastAvailable SinceMay 2, 2022AvailabilityAcademic Institutions and Nonprofits only -
pJEP15-AAV-H1/TO-sgRNA(Tet2)-CMV-TetR-P2A-eGFP-KASH-pA
Plasmid#82701PurposeAAV backbone with a minimal H1/TO promoter driving expression of a sgRNA that targets exon 3 of the mouse Tet2 locus. TracrRNA compatible with SpCas9. gRNA transcription is doxycycline dependent.DepositorInsertH1/TO gRNA Expression Cassette Containing Tet2 gRNA
UseAAV and CRISPRTagsCMV promoter driving expression of TetR-P2A-GFP-K…ExpressionMammalianAvailable SinceDec. 20, 2016AvailabilityAcademic Institutions and Nonprofits only -
Lenti-L227R-tevopreQ1-epegRNA+13C>A_EF1a-puroR (PBS 10 - RTT 19)
Plasmid#207357PurposeLentiviral transfer plasmid encoding hU6-driven expression of a L227R-CFTR correcting prime editing guide (epegRNA) and EF1a-driven puromycin resistance gene.DepositorInsertL227R-CFTR + 13 C>A tevopreq1-prime editing guide RNA (epegRNA)
UseLentiviralAvailable SinceApril 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
JI501: pMAGIC (L3-L2) 3x HA epitope tag + polyA; hU6::SaCas9 gRNA scaffold
Plasmid#121841PurposepMAGIC L3-L2 entry plasmid, contains 3xHA tag+polyA; empty hU6-driven SaCas9 gRNA scaffold for 3-/4-component MultiSite Gateway Pro assembly. Allows C-term epitope fusion to dCas9 w/ gRNA expressionDepositorTypeEmpty backboneUseSynthetic Biology; Pmagic gateway entry plasmidAvailable SinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
pMB1052:miniTol2-U6-(empty)SaCas9_gRNA-CAG-Cre-P2A-NeoR-WPRE
Plasmid#168108PurposeTol2 transposon vector of empty U6-S.aureus Cas9 gRNA cassette and CAG-driven Cre-NeoRDepositorTypeEmpty backboneUseCRISPR and Cre/LoxAvailable SinceJuly 12, 2021AvailabilityAcademic Institutions and Nonprofits only -
pW301-lenti-spsgRNA-hsITGB1-pEF1s-NLS-mNeonGreen-P2A-BlastR
Plasmid#170817PurposeLentiviral vector to co-express a human ITGB1 spsgRNA with NLS-mScarlet-IDepositorInsertNLS-mNeonGreen-P2A-BlastR
UseLentiviralExpressionMammalianMutationNAAvailable SinceJune 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCAG-eCas9-T2A-EGFP-U6-gRNA targeting Nrl-no ITR and f1 ori
Plasmid#234737PurposeAll-in-one CRISPR/Cas9 vector encodes high-fidelity eSpCas9 and a gRNA targeting Nrl, efficiently reprogramming rod precursors into cone-like cells in the mouse retina.DepositorAvailable SinceApril 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLV hU6-VEGFR2#3 sgRNA Nestin-dCas9-KRAB-T2a-GFP
Plasmid#196990PurposeDerived from pLV hU6-sgRNA Nestin-dCas9-KRAB-T2a-GFP with KDR sgRNADepositorInsertVEGFR2
UseCRISPR and LentiviralAvailable SinceApril 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-MYL2-TadA8e-SpN aa2-713- inteinN-U6-Camk2d sgRNA7
Plasmid#226915PurposeExpresses TadA8e and Sp cas9N by MYL2 promoter and sgRNA targeting murine Camk2d intron7 5' splice site by U6 promoterDepositorInsertMYL2, TadA, nSp Cas9N, inteinN
UseAAVPromoterMYL2Available SinceJan. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-MYL2-HA-TadA8e-Sauri N aa1-438-inteinN-U6-Camk2d sgRNA7
Plasmid#226678PurposeExpresses TadA8e and Sauri cas9N by MYL2 promoter and sgRNA targeting murine Camk2d intron7 5' splice site by U6 promoterDepositorInsertMYL2, TadA, nSauri Cas9N, inteinN
UseAAVPromoterMYL2Available SinceJan. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLV-RnSyt1-sgRNA2-dCas9-KRAB-TagBFP2 (identifier AAAA-0246)
Plasmid#202555PurposeSynaptotagmin-1 sgRNA2 with TagBFP2DepositorInsertCRISPRi single guide RNA sequence against 5’-UTR of rat synaptotagmin-1 (Syt1) gene (insert 5’ - CACCAGTACTCGCGTGCCTCGCACCGG) (Syt1 Rat)
UseCRISPR and LentiviralTags3xFlag (N-terminus of Cas9-KRAB), T2A-TagBFP2Available SinceDec. 12, 2024AvailabilityAcademic Institutions and Nonprofits only