We narrowed to 10,413 results for: plasmids 101
-
Plasmid#216276PurposeAAV vector with hSynapsin promoter and DIO Lox sites for Cre-On expression of red fluorescent calcium indicator jRGECO1aDepositorInsertNES-jRGECO1a
UseAAV and Cre/LoxTags6XHIS and XpressPromoterhuman synapsin 1 (hSyn)Available SinceMay 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Ef1a-FAS-GCaMP6f-WPRE
Plasmid#141237PurposeAAV vector with Ef1a promoter and LoxFAS sites for Cre-Off expression of GCaMP6f (GCaMP6f will not be expressed in mammalian cells that express Cre recombinase)DepositorInsertGCaMP6f
UseAAV and Cre/LoxTags6XHIS and XpressPromoterHuman elongation factor-1 alpha (EF-1 alpha)Available SinceApril 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAS_4xMmaPylT(UUA)_EF1_sfGFP150TAA
Plasmid#174897Purposeochre suppression reporter sfGFP150TAA expression, with MmaPylT(UUA) ochre suppressor tRNA cassetteDepositorInsertsf GFP
ExpressionMammalianMutation150TAA in sfGFPPromoterEF1Available SinceNov. 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAS_4xMmaPylT(UCA)_EF1_sfGFP150TGA
Plasmid#174898Purposeopal suppression reporter sfGFP150TGA expression, with MmaPylT(UCA) opal suppressor tRNA cassetteDepositorInsertsfGFP
ExpressionMammalianMutation150TGA in sfGFPPromoterEF1Available SinceNov. 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
pHR-LS
Plasmid#205438PurposeExpression of Gaussia luciferase (gLuc) and spectinomycin resistance (Spec) genesDepositorInsertsGaussia luciferase gene
spectinomycin resistance gene
UseCre/Lox and Luciferase; Chlamydomonas expressionPromoterHeat shock protein 70A (HSP70A)/ribulose bisphosp…Available SinceAug. 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
pBABR mCherry-Bcd-LEXY
Plasmid#182596PurposeDrosophila integration plasmid expressing mCherry-Bcd-LEXY fusion protein under the maternal tubulin promoter.DepositorAvailable SinceAug. 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
PB-TAC-OKMS-KRAB-dCas9
Plasmid#120356PurposepiggyBac transposon for dox-inducible expression of the OKMS (Oct4, Klf4[10-483], c-Myc, Sox2) polycistronic reprogramming cassette (with mCherry). KRAB-dCas9 is constitutively expressed.DepositorInsertOKMS cassette
UseCRISPR; Piggybac transposonExpressionMammalianMutationKlf4 [10-483]Available SinceApril 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
GSX2-P2A-tGFP-DTA
Plasmid#161750PurposetGFP plasmid for the c-terminal targeting of human GSX2 locusDepositorInsertturboGFP
UseCRISPRTagsP2A-tGFPExpressionMammalianPromoterendogenous GSX2 promoterAvailable SinceDec. 14, 2020AvailabilityAcademic Institutions and Nonprofits only -
pIW040
Plasmid#134127PurposeBacterial expression of human Ska1 microtubule binding domain (MTBD)DepositorAvailable SinceFeb. 7, 2020AvailabilityAcademic Institutions and Nonprofits only -
pIW039
Plasmid#134126PurposeBacterial expression of human Ska1 microtubule binding domain (MTBD)DepositorInsertHis-Precission-human Ska1 MTBD (SKA1 Human)
ExpressionBacterialMutationaa 132-255 and K203A K206AAvailable SinceFeb. 7, 2020AvailabilityAcademic Institutions and Nonprofits only -
pIW028
Plasmid#134125PurposeBacterial expression of human Ska1 microtubule binding domain (MTBD)DepositorInsertHis-Precission-human Ska1 MTBD (SKA1 Human)
ExpressionBacterialMutationaa 132-255 and K183A K184AAvailable SinceFeb. 7, 2020AvailabilityAcademic Institutions and Nonprofits only -
PLKO.1-UPF3B-3'UTR
Plasmid#136044PurposeUPF3B shRNA (Targeting 3'UTR) inserted into the PLKO.1 plasmid (CAGGGCAAAGAATAGAGAGAA)DepositorAvailable SinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pPRIME-CMV-GFP-shNts2
Plasmid#132714PurposeEncodes short hairpin RNA (shRNA) #2 that targets the 3’-untranslated region of the rat NtsDepositorAvailable SinceOct. 25, 2019AvailabilityAcademic Institutions and Nonprofits only -
pPRIME-CMV-GFP-shNts1
Plasmid#132713PurposeEncodes short hairpin RNA (shRNA) #1 that targets the the 3’-untranslated region of the rat Nts geneDepositorAvailable SinceOct. 25, 2019AvailabilityAcademic Institutions and Nonprofits only -
pGL4.13/GUG, AAA(30)-FFLuc-3XFLAG
Plasmid#127335PurposeExpress 3xFLAG tagged firefly luciferase (FFLuc) from GUG start codon (AUG at codon 30 mutated to AAA)DepositorInsertFirefly luciferase
Tags3xFLAGExpressionMammalianPromoterSV40Available SinceAug. 8, 2019AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1(+)/CUG-stop-nLuc-3XFLAG
Plasmid#127309PurposeExpress 3xFLAG tagged nanoLuciferase (nLuc) from CUG start codon, but translation terminated immediately by stop codonDepositorInsertnanoLuciferase
Tags3xFLAGExpressionMammalianPromoterCMVAvailable SinceAug. 1, 2019AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1(+)/GUG-nLuc-3XFLAG-CL1/PEST
Plasmid#127317PurposeExpress 3xFLAG tagged highly destabilized nanoLuciferase (nLuc) protein from GUG start codonDepositorInsertnanoLuciferase
Tags3xFLAG and CL1/PESTExpressionMammalianPromoterCMVAvailable SinceAug. 1, 2019AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1(+)/CUG-nLuc-3XFLAG-PEST
Plasmid#127313PurposeExpress 3xFLAG tagged destabilized nanoLuciferase (nLuc) protein from CUG start codonDepositorInsertnanoLuciferase
Tags3xFLAG and PESTExpressionMammalianPromoterCMVAvailable SinceJune 25, 2019AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1(+)/AUU-nLuc-3XFLAG-CL1/PEST
Plasmid#127319PurposeExpress 3xFLAG tagged highly destabilized nanoLuciferase (nLuc) protein from AUU start codonDepositorInsertnanoLuciferase
Tags3xFLAG and CL1/PESTExpressionMammalianPromoterCMVAvailable SinceJune 25, 2019AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1(+)/GGG-stop-nLuc-3XFLAG
Plasmid#127311PurposeExpress 3xFLAG tagged nanoLuciferase (nLuc) from negative control GGG start codon, but translation terminated immediately by stop codonDepositorInsertnanoLuciferase
Tags3xFLAGExpressionMammalianPromoterCMVAvailable SinceJune 25, 2019AvailabilityAcademic Institutions and Nonprofits only