We narrowed to 14,045 results for: crispr grnas
-
Plasmid#179117PurposeExpresses Fermt2 sgRNAs under the U6 promoter and mcherry protein specifically in astrocytesDepositorInsertFermt2 sgRNA
UseAAVPromoterU6Available SinceNov. 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
lenti-KRAS-G121C/G13A-nick sgRNA
Plasmid#214099PurposeLentiviral vector expressing nicking sgRNA to induce KRAS G12C or G13A mutation using PE3DepositorInsertKRAS G12C or G13A nicking sgRNA
UseLentiviralExpressionMammalianPromoterhU6Available SinceJune 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EFS-TadA8e-Sauri-U6-Lmna sgRNA
Plasmid#206979PurposeExpresses SauriABE8e by EFS promoter and sgRNA targeting murine Lmna c.1621T mutation by U6 promoterDepositorInsertLmna sgRNA
UseAAV; Adenine base editorPromoterU6Available SinceFeb. 13, 2024AvailabilityAcademic Institutions and Nonprofits only -
PCRbluntII-pHES7-STOPgRNA
Plasmid#204349PurposegRNA to target pig HES7 stop codonDepositorInsertPig HES7-STOP-gRNA (HES7 Sus domesticus (pig))
ExpressionMammalianAvailable SinceJan. 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLII-CRISPR for CKA4
Plasmid#238521PurposePlant expression of Cas9 and gRNAs against A. thaliana CK2alpha4DepositorAvailable SinceJune 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pJRH-1345 U6-B2M sgRNA Gag-Cas9 v2
Plasmid#201916PurposeCas9-EDV production plasmid. Expresses the v2 Gag-Cas9 polypeptide (CAG promoter) and B2M sgRNA (human U6 promoter, 5’-GAGTAGCGCGAGCACAGCTA)DepositorInsertsGag-Cas9 v2
B2M sgRNA (Target-specific sequence: 5'- GAGTAGCGCGAGCACAGCTA)
ExpressionMammalianPromoterCAG and Human U6Available SinceAug. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
NLS-R-NmeCas9 (D16A)-HA-NLS_sgRNA EZH guide
Plasmid#246438PurposeAll-in-one plasmid. Expresses R-NmeCas9 in mammalian cells for RNA knockdown. Spacer targeting EZH2 gene.DepositorInsertsNmeCas9
Nme-sgRNA
TagsHA tag, NLS, and SV40 NLSExpressionMammalianMutationchanged Aspartic acid 16 to Alanine, deleted amin…PromoterEF-1 alpha and U6Available SinceOct. 28, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EFS-TadA8e-Sauri-U6-sgRNA scaffold
Plasmid#226921PurposeEncoding SauriABE8e and sgRNA cassette on a single AAVDepositorInsertTadA8e, nSauriCas9
UseAAVPromoterEFSAvailable SinceJan. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
JJ802: pMAGIC (L1-R5) hU6::SaCas9 gRNA scaffold
Plasmid#121812PurposepMAGIC L1-R5 entry plasmid, contains empty human U6-driven SaCas9 gRNA scaffold for 4-component MultiSite Gateway Pro assembly. Protospacer motif can be inserted after BsaI digestion.DepositorTypeEmpty backboneUseSynthetic Biology; Pmagic gateway entry plasmidAvailable SinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EFS-TadA8e-Nme2-U6-sgRNA scaffold
Plasmid#226933PurposeEncoding Nme2ABE8e and sgRNA cassette on a single AAVDepositorInsertTadA8e, nNme2Cas9
UseAAVPromoterEFSAvailable SinceJan. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EFS-TadA8e-SaKKH-U6-sgRNA scaffold
Plasmid#226935PurposeEncoding SaKKHABE8e and sgRNA cassette on a single AAVDepositorInsertTadA8e, nSaKKHCas9
UseAAVPromoterEFSAvailable SinceJan. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
LF901: pMAGIC (L1-R5) mU6::SaCas9 gRNA scaffold
Plasmid#121811PurposepMAGIC L1-R5 entry plasmid, contains empty mouse U6-driven SaCas9 gRNA scaffold for 4-component MultiSite Gateway Pro assembly. Protospacer motif can be inserted after BsaI digestion.DepositorTypeEmpty backboneUseSynthetic Biology; Pmagic gateway entry plasmidAvailable SinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCRISPR-Cas9/CD4-TK2
Plasmid#104397PurposeThe designed sgRNA cloned into this plasmid directs the specific DNA cleavage exerted by Cas9 nuclease in a region of exon 5 of the human TK2 gene. The plasmid also includes the Cas9 nuclease and CD4.DepositorAvailable SinceApril 13, 2018AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(SMARCA2(46))-PGKpuro2ABFP-W
Plasmid#200465PurposeLentiviral vector expressing gRNA targeting human SMARCA2DepositorInsertSMARCA2(46) (SMARCA2 Human)
UseLentiviralAvailable SinceJan. 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(SMARCA2(47))-PGKpuro2ABFP-W
Plasmid#200510PurposeLentiviral vector expressing gRNA targeting human SMARCA2DepositorInsertSMARCA2(47) (SMARCA2 Human)
UseLentiviralAvailable SinceJan. 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(SMARCA4(15))-PGKpuro2ABFP-W
Plasmid#200462PurposeLentiviral vector expressing gRNA targeting human SMARCA4DepositorInsertSMARCA4(15) (SMARCA4 Human)
UseLentiviralAvailable SinceJan. 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(SMARCA4(43))-PGKpuro2ABFP-W
Plasmid#200464PurposeLentiviral vector expressing gRNA targeting human SMARCA4DepositorInsertSMARCA4(43) (SMARCA4 Human)
UseLentiviralAvailable SinceJan. 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(GATA3(13))-PGKpuro2ABFP-W
Plasmid#208548PurposeLentiviral vector expressing gRNA targeting human GATA3DepositorInsertGATA3(13) (GATA3 Human)
UseLentiviralAvailable SinceJan. 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(GATA3(12))-PGKpuro2ABFP-W
Plasmid#208547PurposeLentiviral vector expressing gRNA targeting human GATA3DepositorInsertGATA3(12) (GATA3 Human)
UseLentiviralAvailable SinceJan. 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(CDK6-E1(6))-PGKpuro2ABFP-W
Plasmid#200487PurposeLentiviral vector expressing gRNA targeting human CDK6-E1DepositorInsertCDK6-E1(6) (CDK6 Human)
UseLentiviralAvailable SinceApril 1, 2024AvailabilityAcademic Institutions and Nonprofits only