We narrowed to 5,468 results for: pAAV
-
Plasmid#99690PurposeExpresses dSa Cas9 fused to optimized combination of truncated activation domains from SCP1 promoter with dual snRP1 poly adenylation signal, and Sa sgRNA for Actc1, vector allows for strong activation of mouse Actc1, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Actc1 (gRNA sequence: GCCATTCTTGGAGCCAAGGG ) (Actc1 Synthetic, Mouse)
UseAAV and CRISPRTagsVPR miniMutationdead Cas9Available SinceSept. 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
AiP1692 - pAAV-AiE2367m-minBG-SYFP2-WPRE-BGHpA
Plasmid#220661PurposeAiE2367m is an enhancer sequence, designed to drive AAV-mediated transgene expression in specific populations of brain cellsDepositorInsertSYFP2
UseAAVPromoterminBGAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-SCP1-dSa VPR mini.-2X snRP-1 Hbb
Plasmid#99692PurposeExpresses dSa Cas9 fused to optimized combination of truncated activation domains from SCP1 promoter with dual snRP1 poly adenylation signal, and Sa sgRNA for Hbb, vector allows for strong activation of mouse Hbb, can be packaged and delivered as AAVDepositorArticleAvailable SinceJan. 16, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-TRE-DIO-eGFP-2A-TetanusToxin (Cre-OFF)
Plasmid#166611PurposeEncodes Cre-inactivated GFP-2A-Tetanus toxin light chain under control of the TREDepositorInsertEGFP-2A-Tetanus Toxin
UseAAVPromotertetracycline response elementAvailable SinceApril 5, 2021AvailabilityAcademic Institutions and Nonprofits only -
AiP981-pAAV-mscRE4-minBGpromoter-EGFP-WPRE-hGHpA
Plasmid#163484PurposeDirect-expressing EGFP AAV Virus. Alias: AiP981 - pAAV-AiE2004m-minBG-EGFP-WPRE-HGHpADepositorInsertEGFP
UseAAVPromoterBeta Globin minimal promoterAvailable SinceFeb. 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
AiP1530 - pAAV-AiE2115m_3xC2-minBG-SYFP2-WPRE-BGHpA
Plasmid#220657PurposeAiE2115m_3xC2 is an optimized enhancer sequence, designed to drive AAV-mediated transgene expression in specific populations of brain cellsDepositorInsertSYFP2
UseAAVPromoterminBGAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EF1a-double floxed-EYFP-WPRE-HGHpA
Plasmid#20296PurposeCre-activated AAV expression of EYFPDepositorInsertEYFP
UseAAVExpressionMammalianAvailable SinceMay 14, 2009AvailabilityAcademic Institutions and Nonprofits only -
AiP1924 - pAAV-AiE2543m-minBG-SYFP2-WPRE-BGHpA
Plasmid#214583PurposeAiE2543m is an enhancer sequence, designed to drive AAV-mediated transgene expression in specific populations of brain cellsDepositorInsertSYFP2
UseAAVPromoterminBGAvailable SinceJune 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hnEF Coff/Fon hChR2(H134R)-EYFP
Plasmid#55649PurposeCre-off/Flp-on ChR2-EYFP under the short Ef1a promoterDepositorInsertChR2(H134R)-EYFP
UseAAV; Cre off/flp on chr2-eyfpTagsEYFPExpressionMammalianPromoterShort Ef1Available SinceJune 25, 2015AvailabilityAcademic Institutions and Nonprofits only -
1255_pAAV-U6-SA-BbsI-MluI-gRNA-CB-SACas9-HA-OLLAS-spA
Plasmid#109320PurposePlasmid for AAV SaCas9 Mammalian Expression with a BbsI cloning site for a gRNADepositorTypeEmpty backboneUseAAV and CRISPRExpressionMammalianAvailable SinceJune 28, 2018AvailabilityAcademic Institutions and Nonprofits only