We narrowed to 961 results for: ggct
-
Plasmid#227448Purpose6-mer gRNA array targeting Sp dCas9/Cas9 to the Prdm8-Fgf5 locusDepositorInsertCARGO to 7.5kb Upstream Prdm8
UseCRISPRAvailable SinceMay 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
shRNA_circPKHD1_1
Plasmid#215230PurposeSupression of shcircPKHD1(28,29,34,35)_1 expressionDepositorInsertcircPKHD1 shRNA 1 (PKHD1 Human)
UseLentiviralAvailable SinceMarch 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
shRNA_SMAD2_2
Plasmid#215203PurposeSupression of shSMAD2 expressionDepositorInsertSMAD2 shRNA 2 (SMAD2 Human)
UseLentiviralAvailable SinceMarch 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
shRNA_RERE_2
Plasmid#215207PurposeSupression of shRERE_2 expressionDepositorInsertRERE shRNA 2 (RERE Human)
UseLentiviralAvailable SinceMarch 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
shRNA_MTO1_2
Plasmid#215213PurposeSupression of shMTO1_2 expressionDepositorInsertMTO1 shRNA 2 (MTO1 Human)
UseLentiviralAvailable SinceMarch 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAPM-miR30-DHX58-ts2
Plasmid#174245PurposeDHX58 knockdownDepositorAvailable SinceAug. 27, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAPM-miR30-DDX17-ts1
Plasmid#174238PurposeDDX17 knockdownDepositorAvailable SinceAug. 27, 2024AvailabilityAcademic Institutions and Nonprofits only -
pOTTC1642 - pAAV EF1a EGFP-KASH with mTACR1 gRNAs
Plasmid#195018PurposeAn adeno-associated viral vector expressing eGFP-KASH and two guides targeting mouse TACR1DepositorInsertsCCGTATAGGCGGCTGCCCAA
EGFP-KASH
TTCCGTGGTGGGCAACGTAG
UseAAVTagsKASH domain of Nesprin2PromoterEF1a, hU6, and mU6Available SinceJune 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSLQ7578 pHR (hU6-crPROX-EFS-PuroR-WPRE)
Plasmid#214882PurposeLentiviral vector encoding RfxCas13d targeting PROX guide arrayDepositorInserthU6-crPROX-EFS-PuroR-WPRE
UseCRISPR and LentiviralExpressionMammalianPromoterhU6Available SinceApril 4, 2024AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(Control(1))-PGKpuro2AmCherry-W
Plasmid#210612PurposeLentiviral vector expressing gRNA targeting a control region at the CXCR4 locusDepositorInsertControl(1)
UseLentiviralAvailable SinceJan. 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSPgRNA_-60_Enh_3
Plasmid#210623PurposegRNA target sequences for TAL1 -60 EnhancerDepositorInsertTAL1 -60 Enhancer gRNA (TAL1 Human)
UseCRISPRAvailable SinceJan. 3, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLenti-Cas9-ZNF746
Plasmid#207822PurposeDual expression of Cas9 and sgRNA targeting ZNF746DepositorAvailable SinceDec. 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLV_dCas9-ZIM3-KRAB_sgTAOK2i_#1
Plasmid#172983PurposeCRISPRi for TAOK2DepositorAvailable SinceOct. 11, 2023AvailabilityAcademic Institutions and Nonprofits only -
pX330_SAFB2gRNA12
Plasmid#196106PurposeContains guide RNA to 3' end of mouse SAFB2 gene for safb1/2 dko. Used with Addgene IDs: 196103, 196107, 196108DepositorAvailable SinceSept. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
piwi_sgRNA
Plasmid#186653Purposepiwi sgRNA plasmidDepositorInsertPiwi sgRNA Plasmid (piwi Fly)
ExpressionInsectAvailable SinceAug. 10, 2022AvailabilityAcademic Institutions and Nonprofits only -
Tol2-LyzC-Rac-DN(guide resistant)-2a-mcherry-U6ac-Rac guides
Plasmid#168243Purpose"Dominant negative control of the assay to rescue Rac expression in neutrophil specific knockout"DepositorInsertRac(guide resistant)-DN
UseZebrafish expressionTagsmcherryPromoterLyzCAvailable SinceMarch 16, 2022AvailabilityAcademic Institutions and Nonprofits only -
Tol2-LyzC-Rac-CA(guide resistant)-2a-mcherry-U6ac-Rac guides
Plasmid#168244Purpose"Rescue Rac-CA expression in neutrophil specific knockout"DepositorInsertRac(guide resistant)-CA
UseZebrafish expressionTagsmcherryPromoterLyzCAvailable SinceMarch 16, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLCHKO_HPRT1_exon3_1_As
Plasmid#155057PurposeLentiviral plasmid for expressing U6 driven hybrid guide (hg)RNA for deletion of HPRT1 exon 3 using SpCas9 and AsCas12a nucleases (CHyMErA system)DepositorInsert(hg)RNA for deletion of HPRT1 exon 3
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceAug. 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLCHKO_HPRT1_exon3_2_As
Plasmid#155058PurposeLentiviral plasmid for expressing U6 driven hybrid guide (hg)RNA for deletion of HPRT1 exon 3 using SpCas9 and AsCas12a nucleases (CHyMErA system)DepositorInsert(hg)RNA for deletion of HPRT1 exon 3
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceAug. 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLCHKO_HPRT1_exon2_2_As
Plasmid#155056PurposeLentiviral plasmid for expressing U6 driven hybrid guide (hg)RNA for deletion of HPRT1 exon 2 using SpCas9 and AsCas12a nucleases (CHyMErA system)DepositorInsert(hg)RNA for deletion of HPRT1 exon 2
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceAug. 12, 2020AvailabilityAcademic Institutions and Nonprofits only