We narrowed to 17,159 results for: REV
-
Plasmid#60327PurposeContains a promoter of two gal binding sites coupled with a core promoter derived from native Leucine promoterDepositorInsertpromoter
UseSynthetic Biology; Yeast synthetic hybrid promote…ExpressionYeastAvailable SinceNov. 6, 2014AvailabilityIndustry, Academic Institutions, and Nonprofits -
Dom34(265-386)
Plasmid#19102DepositorAvailable SinceDec. 15, 2008AvailabilityAcademic Institutions and Nonprofits only -
pET28b-sad1-C63A
Plasmid#90302Purposeprotein expressionDepositorInsertSAD1
TagsHis tagExpressionBacterialMutationC63AAvailable SinceJune 18, 2021AvailabilityAcademic Institutions and Nonprofits only -
pVW284
Plasmid#139494PurposeExpression vector for the PP7-GFP protein in S. cerevisiaeDepositorInsertpADH1 PP7∆FG-GFPenvy tCYC1
ExpressionYeastMutation∆FGPromoterpADH1Available SinceJune 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pVW300
Plasmid#139495PurposeExpression vector for the PP7-GFP protein in S. cerevisiaeDepositorInsertpTEF PP7∆FG-GFPenvy tCYC1
ExpressionYeastMutation∆FGPromoterpTEFAvailable SinceJune 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
ZJOM8
Plasmid#133671PurposeIntegration of SNF7-GFP as an additional copy in genome, use auxotrophic marker URA3(Candida albicans). Present on endosomes and vacuolar surface.DepositorAvailable SinceFeb. 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
pMM0617
Plasmid#128993PurposeloxP-KIURA3-loxP preassembled entry vectorDepositorInsertKanR-ColE1 URA 5' homology-ConLS'-sfGFP dropout-ConRE'-loxP-KIURA3-loxP-URA3 5' homology
ExpressionYeastAvailable SinceOct. 16, 2019AvailabilityAcademic Institutions and Nonprofits only -
pGLx2-set1deltaRRM
Plasmid#53257PurposeGAL driven LexA-tagged SET1-deltaRRM (RRM domain deleted)DepositorInsertSET1
TagsLexAExpressionYeastMutationRRM domain deleted (aa 230-355)PromoterGAL1/10Available SinceJuly 15, 2014AvailabilityAcademic Institutions and Nonprofits only -
YEplac181-RTS1
Plasmid#8626DepositorAvailable SinceNov. 15, 2005AvailabilityAcademic Institutions and Nonprofits only -
ClhN-4V5-APEX2-URA
Plasmid#207056PurposeFor ORF tagging with 4V5-APEX2DepositorInsert4xV5-APEX2
Tags4xV5-APEX2ExpressionYeastAvailable SinceMarch 4, 2024AvailabilityAcademic Institutions and Nonprofits only -
pHHYTK124
Plasmid#200136PurposeType 3a part for Modular Cloning in YeastDepositorInsertIMS-Mia40 (2-70)
UseSynthetic BiologyExpressionBacterialAvailable SinceMay 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCLASP_Crz1(19A)_CLASP_RGS2membrane
Plasmid#133085PurposePlasmid contains Crz1* with CLASP. This consists of the plasma membrane anchor (pm-LOVTRAP) and the cargo (Zdk-Crz1*-yeLANS). CLASP modulates nuclear localization of Crz1* in response to blue light.DepositorInsertCrz1*-CLASP
ExpressionBacterial and YeastPromoterpADH1Available SinceSept. 16, 2020AvailabilityAcademic Institutions and Nonprofits only -
pSP571
Plasmid#139498PurposeCRISPR-Cas9 plasmid to generate double strand break in STL1 locus in S. cerevisiae. Expresses both Cas9 and STL1 sgRNADepositorInsertpGPD Cas9 / sgRNA (STL162)
ExpressionYeastMutationWTPromoterpGPDAvailable SinceJune 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
pTJK517
Plasmid#121474PurposeCEN TRP1 CNA1DepositorInsertCNA1
UseYeast cen vectorPromoterEndogenous genomic promoter regionAvailable SinceApril 23, 2019AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-R-ARS607c
Plasmid#87409Purposep426_Cas9_gRNA-ARS607c without ribozyme All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS607c sequence CTATTTTTGCTTTCTGCACA in yeast chromosome 6.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS607c
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-CAN1y
Plasmid#87391PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting CAN1y sequence GATACGTTCTCTATGGAGGA in yeast chromosome 6.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting CAN1y
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS720a
Plasmid#87392PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS720a sequence CAACAATTGTTACAATAGTA in yeast chromosome 7.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS720a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS1021b
Plasmid#87395PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1021b sequence CCTCTGTGTGGTGGTAATTG in yeast chromosome 10.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS1021b
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS1114a
Plasmid#87397PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1114a sequence CTTGTGAAACAAATAATTGG in yeast chromosome 11.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS1114a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS1414a
Plasmid#87400PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1414a sequence GCGCCACAGTTTCAAGGGTC in yeast chromosome 14.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS1414a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only