We narrowed to 10,767 results for: yeast
-
Plasmid#78988PurposeSupplemental Figure 4. Promoter short ppTEF1. Expresses GFP.DepositorInsertGFP
ExpressionYeastAvailable sinceAug. 23, 2016AvailabilityAcademic Institutions and Nonprofits onlyCited by -
PP149
Plasmid#78989PurposeSupplemental Figure 4. Promoter WT GAP. Expresses GFP.DepositorInsertGFP
ExpressionYeastAvailable sinceAug. 23, 2016AvailabilityAcademic Institutions and Nonprofits only -
PP154
Plasmid#78991PurposeSupplemental Figure 4. Promoter GAP1. Expresses GFP.DepositorInsertGFP
ExpressionYeastAvailable sinceAug. 23, 2016AvailabilityAcademic Institutions and Nonprofits only -
PP162
Plasmid#78995PurposeSupplemental Figure 4. Promoter GAP5. Expresses GFP.DepositorInsertGFP
ExpressionYeastAvailable sinceAug. 23, 2016AvailabilityAcademic Institutions and Nonprofits onlyCited by -
PP324
Plasmid#78982Purpose246B. Promoter: GAP6, minimal Promoter: AOX1. Figure 5. Expresses rHGH and IFNa2b.DepositorInsertsrHGH
IFNa2b
ExpressionYeastAvailable sinceAug. 23, 2016AvailabilityAcademic Institutions and Nonprofits only -
PP246
Plasmid#78966PurposePromoter: GAP6, minimal Promoter: AOX1. Figure 4. Expresses GFP.DepositorInsertGFP
ExpressionYeastAvailable sinceAug. 23, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCfB2374
Plasmid#67534PurposeEasyClone system-based yeast integrative vector carrying loxP-flanked KlURA3 marker, integration into S. cerevisiae XI-1 chromosomal location, USER site for cloning, amp resistanceDepositorTypeEmpty backboneUseCre/Lox; IntegrativeExpressionYeastAvailable sinceMarch 10, 2016AvailabilityAcademic Institutions and Nonprofits only -
pJW3.42
Plasmid#62866PurposeYeast two-hybrid bait vector expressing LexA-PPTR-1 fusionDepositorInsertPPTR-1/pLexA-N bait
UseTwo-hybrid bait vectorTagsLexAExpressionYeastAvailable sinceMarch 18, 2015AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS1622b
Plasmid#87403PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1622b sequence GTCACGTTCCTGAGGTTACT in yeast chromosome 16.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS1622b
UseCRISPRPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-YPRCd15c
Plasmid#87404PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting YPRCd15c sequence AATCCGAACAACAGAGCATA in yeast chromosome 14.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting YPRCd15c
UseCRISPRPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS106a
Plasmid#87382PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS106a sequence ATACGGTCAGGGTAGCGCCC in yeast chromosome 1.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS106a
UseCRISPRPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS308a
Plasmid#87384PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS308a sequence CACTTGTCAAACAGAATATA in yeast chromosome 3DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS308a
UseCRISPRPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCfB3034(X-3 MarkerFree)
Plasmid#73272PurposeEasyClone-MarkerFree backbone vector for the addition of 1 or 2 genes and promoters for integration into site X-3 (Chr X: 223616..224744)DepositorTypeEmpty backboneUseCRISPR and Synthetic BiologyExpressionYeastAvailable sinceNov. 23, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCfB3039(XII-2 MarkerFree)
Plasmid#73279PurposeEasyClone-MarkerFree backbone vector for the addition of 1 or 2 genes and promoters for integration into site XII-2 (Chr XII: 808805..809939)DepositorTypeEmpty backboneUseCRISPR and Synthetic BiologyExpressionYeastAvailable sinceNov. 23, 2016AvailabilityAcademic Institutions and Nonprofits only -
-
-
pYO1943
Plasmid#252685PurposeExpression of ZZ-TEV-HsBeclin1 (F97A I100A) in yeastDepositorAvailable sinceSept. 4, 2026AvailabilityAcademic Institutions and Nonprofits only -
Leu Cen/ars Tef mNg-MinDec, Tef MinEec-mRuby2
Plasmid#252613PurposeCen/ars plasmid for expressing mNg-MinD and MinEec-mRuby2 in budding yeast under Leu2 auxotrophic selectionDepositorInsertsmNeongreen-MinDec fusion
MinEec-mRuby2
TagsmNeongreen and mRuby2ExpressionYeastAvailable sinceAug. 10, 2026AvailabilityAcademic Institutions and Nonprofits only -
nup159[mApple]_bar
Plasmid#251400PurposeEnables endogenous C-terminal tagging of the nuclear pore complex component NCU08604, which encodes the homolog of yeast Nup159, with mApple.DepositorInsertNCU08604
UseNeurospora expressionTagsmAppleAvailable sinceMay 27, 2026AvailabilityAcademic Institutions and Nonprofits only -
pYO1879
Plasmid#242480PurposeIntegrate dRFP-ScVPS21 Q66L into the yeast genome with LEU2 markerDepositorInsertVPS21, LEU2
Tags2xDsRedExpressExpressionBacterialMutationQ66LAvailable sinceMarch 18, 2026AvailabilityAcademic Institutions and Nonprofits only