We narrowed to 10,433 results for: yeast
-
Plasmid#62850PurposeDonor vector for gene editing at human TUBA1B locusDepositorInsertmTagRFP-TUBA1B (TUBA1B Human, Synthetic)
UseYeast-e.coli shuttle vectorAvailable SinceMay 26, 2015AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS308a
Plasmid#87384PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS308a sequence CACTTGTCAAACAGAATATA in yeast chromosome 3DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS308a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS1114a
Plasmid#87397PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1114a sequence CTTGTGAAACAAATAATTGG in yeast chromosome 11.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS1114a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pBSWHhc-p53
Plasmid#133903PurposePositive control when used in combination with pAWH-largeT. Expression of Gal4BD-p53 hybrid protein. Homology regions for recombination with pAWHDepositorAvailable SinceDec. 20, 2019AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-HIS3b
Plasmid#87402PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting HIS3b sequence AATATAGAGTGTACTAGAGG in yeast chromosome 15.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting HIS3b
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pH-eCFP
Plasmid#176555PurposeExpression of eCFP for auxotrophic selection in the absence of histidineDepositorInserteCFP
ExpressionYeastPromoterTDH1(GAP)Available SinceApril 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
pL-eCFP
Plasmid#176556PurposeExpression of eCFP for auxotrophic selection in the absence of leucineDepositorInserteCFP
ExpressionYeastPromoterTDH1(GAP)Available SinceApril 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
pU-eCFP
Plasmid#176557PurposeExpression of eCFP for auxotrophic selection in the absence of uracilDepositorInserteCFP
ExpressionYeastPromoterTDH1(GAP)Available SinceApril 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
pU-mRuby2
Plasmid#176549PurposeExpression of mRuby2 for auxotrophic selection in the absence of uracilDepositorInsertyomRuby2
ExpressionYeastPromoterTDH1(GAP)Available SinceOct. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pH-mRuby2
Plasmid#176547PurposeExpression of mRuby2 for auxotrophic selection in the absence of histidineDepositorInsertyomRuby2
ExpressionYeastPromoterTDH1(GAP)Available SinceApril 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS1622b
Plasmid#87403PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1622b sequence GTCACGTTCCTGAGGTTACT in yeast chromosome 16.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS1622b
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS1309a
Plasmid#87399PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1309a sequence CCTGTGGTGACTACGTATCC in yeast chromosome 13.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS1309a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS911b
Plasmid#87394PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS911b sequence GTAATATTGTCTTGTTTCCC in yeast chromosome 9.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS911b
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
416Gal-FUS-H517Q-YFP
Plasmid#29620DepositorAvailable SinceApril 27, 2011AvailabilityAcademic Institutions and Nonprofits only -
416Gal-FUS-R521H-YFP
Plasmid#29624DepositorAvailable SinceApril 27, 2011AvailabilityAcademic Institutions and Nonprofits only -
pCS2+ cMyc-oDam_f_GFPoNLS
Plasmid#85818PurposeiDamID plasmid. To express transiently the c-Myc-tagged and optimized E. coli Dam adenine methyltransferase fused to the nuclear-localized mmGFP via flexylinker.DepositorInsertcMyc oDam_f_GFPoNLS
TagscMyc and oNLS (optimized nuclear localization sig…ExpressionBacterial, Insect, Mammalia…MutationL122A. Codon optimization compatible to work in M…Available SinceJan. 4, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCLASP_Crz1(19A)_CLASP_RGS2membrane
Plasmid#133085PurposePlasmid contains Crz1* with CLASP. This consists of the plasma membrane anchor (pm-LOVTRAP) and the cargo (Zdk-Crz1*-yeLANS). CLASP modulates nuclear localization of Crz1* in response to blue light.DepositorInsertCrz1*-CLASP
ExpressionBacterial and YeastPromoterpADH1Available SinceSept. 16, 2020AvailabilityAcademic Institutions and Nonprofits only -
nuc-yHS1-M7A,H102A
Plasmid#159168PurposeNuclear labile heme reporterDepositorInsertnuc-yHS1-M7A,H102A
TagsSV40 NLSExpressionYeastMutationMutated both Met 7 and His 102 of the cyt b562 mo…PromoterGPDAvailable SinceSept. 29, 2020AvailabilityIndustry, Academic Institutions, and Nonprofits -
426Gal-FUS-1-501aa-YFP
Plasmid#29601DepositorAvailable SinceJune 7, 2011AvailabilityAcademic Institutions and Nonprofits only -
426Gal-FUS-1-373aa-YFP
Plasmid#29598DepositorAvailable SinceApril 27, 2011AvailabilityAcademic Institutions and Nonprofits only -
426Gal-FUS-1-170aa-YFP
Plasmid#29596DepositorAvailable SinceApril 29, 2011AvailabilityAcademic Institutions and Nonprofits only -
G30, Cdc20-mCherry-AID tagging
Plasmid#130270PurposeTagging the Saccharomyces cerevisiae Cdc20 gene with a mCherry and auxin-degron tag, via homologous recombinationDepositorInsertCdc20/mCherry-AID(71-114)-tCYC1-NatMX (CDC20 Budding Yeast, Synthetic)
TagsAID(71-114) and mCherryExpressionYeastPromoterNative promoterAvailable SinceSept. 11, 2019AvailabilityAcademic Institutions and Nonprofits only -
416Gal-FUS-R514G-YFP
Plasmid#29616DepositorAvailable SinceApril 27, 2011AvailabilityAcademic Institutions and Nonprofits only -
426Gal-FUS-1-413aa-YFP
Plasmid#29599DepositorAvailable SinceJuly 18, 2011AvailabilityAcademic Institutions and Nonprofits only -
pCfB3053(gRNA X-2, XI-5, XII-4)
Plasmid#73295PurposeEasyClone-MarkerFree guiding RNA vector to direct Cas9 to cut at sites X-2, XI-5, and XII-4DepositorInsertguiding RNA
UseCRISPR; GrnaExpressionYeastAvailable SinceNov. 23, 2016AvailabilityAcademic Institutions and Nonprofits only -
426Gal-FUS-101-526aa-YFP
Plasmid#29603DepositorAvailable SinceJuly 20, 2011AvailabilityAcademic Institutions and Nonprofits only -
426Gal-FUS-1-453aa-YFP
Plasmid#29600DepositorAvailable SinceApril 27, 2011AvailabilityAcademic Institutions and Nonprofits only -
426Gal-FUS-267-526aa-YFP
Plasmid#29605DepositorAvailable SinceApril 27, 2011AvailabilityAcademic Institutions and Nonprofits only -
pIRES:mTREK-1(K271Q)
Plasmid#133273PurposeMammalian expression vector. It will generate the mouse TREK-1 channel full lenght K271Q mutant fused to a N-terminal HA tagDepositorInsertPotassium channel subfamily K member 2 (KCNK2, TREK-1) (Kcnk2 Mouse)
TagsHAExpressionMammalian and YeastMutationK271QAvailable SinceApril 27, 2020AvailabilityAcademic Institutions and Nonprofits only -
426Gal-FUS-285-526aa-YFP
Plasmid#29606DepositorAvailable SinceSept. 7, 2011AvailabilityAcademic Institutions and Nonprofits only