We narrowed to 15,985 results for: grna
-
Plasmid#64116PurposeVector for expression of St1 sgRNA1.1 in mammalian cellsDepositorInsertSt1 sgRNA1.1
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available sinceApril 24, 2015AvailabilityAcademic Institutions and Nonprofits only -
pBBK10 pCAS-Tyr-[gRNA: BsaI GFP dropout] (SplitURA3,AmpR)
Plasmid#178994PurposeSp.Cas9 and gRNA yeast expression vector for Golden Gate pre-cloning of gRNA. Selection = SplitURA3DepositorInsertS. pyogenes Cas9
UseCRISPR and Synthetic BiologyExpressionYeastAvailable sinceMay 2, 2022AvailabilityAcademic Institutions and Nonprofits only -
pBBK08 pCAS-Tyr-[gRNA: BsaI GFP dropout] (SplitLEU2,AmpR)
Plasmid#178992PurposeSp.Cas9 and gRNA yeast expression vector for Golden Gate pre-cloning of gRNA. Selection = SplitLEU2DepositorInsertS. pyogenes Cas9
UseCRISPR and Synthetic BiologyExpressionYeastAvailable sinceMay 2, 2022AvailabilityAcademic Institutions and Nonprofits only -
pT2K-CAGGS-U6-sgRNA-M9-IRES-CFP
Plasmid#114731PurposesgRNA targeting a sequence upstream of the initiator ATG of the cellular Myc geneDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertsgRNA M9
UseCRISPRExpressionMammalianAvailable sinceDec. 3, 2018AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPR - Amplicon, BCR/ABL sgRNA 1
Plasmid#70659PurposeExpresses human codon-optimized Cas9 protein and puromycin resistance from EFS promoter and an intergenic BCR/ABL-targeting sgRNA element from U6 promoter. Lentiviral backboneDepositorPublicationInsertsgRNA against BCR/ABLamplicon found in CML-derived K562 cell line
UseCRISPR and LentiviralExpressionMammalianAvailable sinceOct. 13, 2016AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-puro U6 sgRNA SOX17 -296
Plasmid#50926PurposeU6 driven sgRNA targeting Sox17 -296 bp from TSSDepositorAvailable sinceJan. 22, 2014AvailabilityAcademic Institutions and Nonprofits only -
pSB700 lenti gRNA Blasto
Plasmid#167904PurposeLentiviral vector for expressing U6 sgRNA cloning plasmidDepositorTypeEmpty backboneUseCRISPR and LentiviralAvailable sinceMay 18, 2022AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pSB700 lenti gRNA Puro
Plasmid#167911PurposeLentiviral vector for expressing U6 sgRNA cloning plasmidDepositorTypeEmpty backboneUseCRISPR and LentiviralAvailable sinceFeb. 9, 2022AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pX459_gRNA-ROSA26_hspCas9
Plasmid#193310PurposeCas9 from S. pyogenes and U6 ROSA26 sgRNA (V2.0)DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertCas9 from S. pyogenes and U6 ROSA26 sgRNA (V2.0)
UseCRISPRExpressionMammalianMutationnot applicableAvailable sinceDec. 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA-d5-HT1AR
Plasmid#221820PurposePlasmid to express gRNA (gaccagtccactaccgcagc) for editing at the end of Drosophila 5-HT1AR coding frameDepositorAvailable sinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA-d5-HT7R
Plasmid#221829PurposePlasmid to express gRNA (ggcgagggagagctttctct) for editing at the end of Drosophila 5-HT1AR coding frameDepositorAvailable sinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCDNA-H1-sgRNA-mTZAP
Plasmid#87187PurposeguideRNA targeting exon2 of mouse TZAPDepositorAvailable sinceMarch 10, 2017AvailabilityAcademic Institutions and Nonprofits onlyCited by -
sgRNA(MS2)_Prnp_SAM2
Plasmid#78625PurposeEncodes sgRNA2.0 targeting 138nt upstream of TSSDepositorAvailable sinceJuly 19, 2016AvailabilityAcademic Institutions and Nonprofits only -
sgRNA(MS2)_Prnp_SAM1
Plasmid#78624PurposeEncodes sgRNA2.0 targeting 158nt upstream of TSSDepositorAvailable sinceJuly 19, 2016AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPR v2-sgSLC7A11/xCT-1
Plasmid#161818Purposeknock out SLC7A11/xCT in mammalian cellsDepositorInsertSLC7A11 solute carrier family 7 member 11 xCT (SLC7A11 Human)
UseCRISPR and LentiviralAvailable sinceDec. 8, 2020AvailabilityAcademic Institutions and Nonprofits only -
pRDA_118
Plasmid#133459PurposeU6 promoter expresses customizable Spyo-guide; EF1a promoter provides puromycin resistance. This vector is a derivative of the lentiGuide vector, with minor modifications to the tracrRDepositorInsertcontrol guide
UseCRISPR and LentiviralExpressionMammalianAvailable sinceOct. 29, 2019AvailabilityAcademic Institutions and Nonprofits onlyCited by -
PTEN shRNA
Plasmid#86645Purposeexpression of shRNA targeting PTENDepositorPublicationAvailable sinceMay 10, 2017AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pSicoR human Dicer3
Plasmid#14765DepositorAvailable sinceApril 5, 2007AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pSico Dnmt1
Plasmid#12165PurposeCre-regulated lentiviral shRNA vector. Cre addition causes EGFP to be recombined out of the construct, activating Dnmt1 shRNA expression.DepositorInsertDnmt1 shRNA (Dnmt1 Mouse)
UseCre/Lox, Lentiviral, and RNAiExpressionMammalianMutationEGFP is expressed from this plasmid as a marker, …Available sinceJune 30, 2006AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(hYAP1-Y2B)-PGKpuro2ABFP-W
Plasmid#163178PurposeLentiviral gRNA plasmid targeting human YAP1 gene, co-expression of BFP tagDepositorAvailable sinceFeb. 19, 2021AvailabilityAcademic Institutions and Nonprofits only