We narrowed to 60,877 results for: Ran
-
Plasmid#195979PurposeExpression constructDepositorInsertubi:mCerulean
UseOtherAvailable SinceFeb. 10, 2023AvailabilityAcademic Institutions and Nonprofits only -
GLRX-roGFP2 in pT3TS-Dest
Plasmid#194297PurposeIn vitro transcription of the redox sensor GLRX-roGFP2 from the T3 promoter. Parton lab clone KRKDepositorInsertGLRX-roGFP2
UseIn vitro transcription of mrnaAvailable SinceFeb. 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSEVA424::tsi5
Plasmid#192960PurposeExpresses the protein Tsi51-76 for biological function studies in a broad-spectrum of organismsDepositorInserttsi5
ExpressionBacterialAvailable SinceFeb. 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
pGWT35S-AtOEP7(1-50aa)-VC155
Plasmid#194046PurposeTransient expression of AtOEP7-VC155 (mVenus β-strands 8 to 11, amino acids 155−239) in plant cell (Chloroplast outer envelope membrane)DepositorInsertVC155 (mVenus β-strands 8 to 11, amino acids 155−239)
TagsAtOEP7 1–50aaExpressionPlantPromoterCaMV 35S promoterAvailable SinceJan. 18, 2023AvailabilityAcademic Institutions and Nonprofits only -
pGWT35S-AtOEP7(1-50aa)-VN154
Plasmid#194045PurposeTransient expression of AtOEP7-VN154 (mVenus β-strands 1 to 7, amino acids 1−154) in plant cell (Chloroplast outer envelope membrane)DepositorInsertVN154 (mVenus β-strands 1 to 7, amino acids 1−154)
TagsAtOEP7 1–50aaExpressionPlantPromoterCaMV 35S promoterAvailable SinceJan. 18, 2023AvailabilityAcademic Institutions and Nonprofits only -
pET29a(+)::D1141A
Plasmid#192963PurposeTest the activity of the putative aspartyl protease motif DPXGL-(18)-DPXGLDepositorInsertTse5_D1141A
Tags9xhis + TEV tagExpressionBacterialMutationD1141AAvailable SinceDec. 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
pET29a(+)::9xhis-Tse5
Plasmid#192962PurposeHeterologous expression of Tse5 in E. coli Lemo21 cells for purification of Tse5-CTDepositorInsertTse5
Tags9xhis + TEV tagExpressionBacterialAvailable SinceDec. 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
pBSKΔB-24xopto-TetO-no01
Plasmid#174887PurposePlasmid vector containing southern blot probe for opto-TetO in STREAMING-tagDepositorInsert24xopto-TetO
UseSouthern blot probeAvailable SinceDec. 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
hsLEMD2-pX330
Plasmid#179511PurposeEncodes gRNA for human LEMD2DepositorInsertgRNA for LEMD2
UseCRISPRExpressionMammalianPromoterU6Available SinceNov. 2, 2022AvailabilityAcademic Institutions and Nonprofits only -
pNHT7
Plasmid#186753PurposeA basic cloning vector for inserting genes with 5' and 3' UTRs for later subcloning via Golden Gate assembly.DepositorTypeEmpty backboneUseSynthetic Biology; Cloning backbonePromoterT7Available SinceOct. 24, 2022AvailabilityAcademic Institutions and Nonprofits only -
pYI006
Plasmid#170840PurposeFRO6p::GUSPlus::tOCS in pFP100DepositorInsertFRO6p::GUSPlus::tOCS
ExpressionPlantPromoterFRO6Available SinceOct. 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
pYI046
Plasmid#170842Purpose(pUBQ10::SMT2-FLAG::tOCS)DepositorInsertpUBQ10::SMT2-FLAG::tOCS
ExpressionPlantPromoterpUBQ10Available SinceOct. 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
pPBO.ACT002
Plasmid#182712PurposeaTc inducible dCasRx-IF1DepositorInsertdCasRx
UseCRISPRTags3x(GGGS)-Escherichia Coli Initiation Factor 1ExpressionBacterialMutationCatalytically deactivated R295A, H300A, R849A, H8…PromoterpTetAvailable SinceAug. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pPBO.ACT004
Plasmid#182714PurposeConstituitvely expressed CasRx crRNA cloning vector, extended 3' terminator regionDepositorInsertCasRx crRNA cloning backbone
UseCRISPRExpressionBacterialMutationCatalytically deactivated R295A, H300A, R849A, H8…PromoterpJ23119 (TTGACAGCTAGCTCAGTCCTAGGTATAATACTAGT)Available SinceAug. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pT2h70CRET(#325)
Plasmid#184060Purposecyclofen-inducible CRE activation in zebrafish transient transgenicDepositorInsertCRE-ERT2
UseZebrafish transient transgenesisMutationERT2: G400V, M543A, L544A, deleted 1-281;PromoterZf-Hsp70-4Available SinceJuly 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-NLS-QPAS1-VP16
Plasmid#186187PurposeAAV vector packaging QPAS1-VP16, a component of optogenetic system for NIR light-controllable transcriptional activationDepositorInsertNLS-QPAS1-VP16
UseAAVPromoterCAGAvailable SinceJuly 5, 2022AvailabilityAcademic Institutions and Nonprofits only -
pEPQD1CB0802
Plasmid#177083PurposeMoClo Level 1, position 1, transcriptional unit for transient expression of strictosidine synthase (CrSTR) from Catharanthus roseus promoter regions contains 4x attB sites for recruitment fo gal4AD-phiC31DepositorInsertstrictosidine synthase (CrSTR) from Catharanthus roseus
UseSynthetic BiologyAvailable SinceDec. 6, 2021AvailabilityAcademic Institutions and Nonprofits only -
pEPQD1CB0808
Plasmid#177082PurposeMoClo Level 1, position 4, transcriptional unit for transient expression of tryptophan decarboxylase (CrTDC) from Catharanthus roseus promoter regions contains 4x attB sites for recruitment fo gal4AD-phiC31DepositorInserttryptophan decarboxylase (CrTDC) from Catharanthus roseus
UseSynthetic BiologyAvailable SinceDec. 6, 2021AvailabilityAcademic Institutions and Nonprofits only -
pEPQD1CB0863
Plasmid#177081PurposeMoClo Level 1, position 5, transcriptional unit for transient expression of secologanin synthase (CrSLS1) from Catharanthus roseus promoter regions contains 4x attB sites for recruitment fo gal4AD-phiC31DepositorInsertsecologanin synthase (CrSLS1) from Catharanthus roseus
UseSynthetic BiologyAvailable SinceDec. 6, 2021AvailabilityAcademic Institutions and Nonprofits only -
pEPQD1CB0790
Plasmid#177075PurposeMoClo Level 1, position 1, transcriptional unit for transient expression of iridoid synthase (CrISY) from Catharanthus roseus promoter regions contains 4x attB sites for recruitment fo gal4AD-phiC31DepositorInsertiridoid synthase (CrISY) from Catharanthus roseus
UseSynthetic BiologyAvailable SinceDec. 6, 2021AvailabilityAcademic Institutions and Nonprofits only